Incidental Mutation 'R9746:Nadk2'
ID 732158
Institutional Source Beutler Lab
Gene Symbol Nadk2
Ensembl Gene ENSMUSG00000022253
Gene Name NAD kinase 2, mitochondrial
Synonyms 1110020G09Rik, Nadkd1, MNADK, 4933430B08Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9746 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 9071340-9110584 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 9106824 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 37 (R37*)
Ref Sequence ENSEMBL: ENSMUSP00000140212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067760] [ENSMUST00000100789] [ENSMUST00000100790] [ENSMUST00000188194]
AlphaFold Q8C5H8
Predicted Effect silent
Transcript: ENSMUST00000067760
SMART Domains Protein: ENSMUSP00000068318
Gene: ENSMUSG00000022253

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Pfam:NAD_kinase 58 334 4.7e-11 PFAM
Predicted Effect silent
Transcript: ENSMUST00000100789
SMART Domains Protein: ENSMUSP00000098353
Gene: ENSMUSG00000022253

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Pfam:NAD_kinase 58 171 8.2e-10 PFAM
Predicted Effect silent
Transcript: ENSMUST00000100790
SMART Domains Protein: ENSMUSP00000098354
Gene: ENSMUSG00000022253

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Pfam:NAD_kinase 58 312 3.9e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000188194
AA Change: R37*
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial kinase that catalyzes the phosphorylation of NAD to yield NADP. Mutations in this gene result in 2,4-dienoyl-CoA reductase deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for knock-out allele exhibit increased serum lysine and carnitine levels, develop increased reactive oxygen species levels and hepatic steatosis on an atherogenic high-fat diet, and show impaired fasting-induced fatty acid oxidation. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,159,598 (GRCm39) H307L probably benign Het
Acnat1 A T 4: 49,450,652 (GRCm39) L153H probably damaging Het
Actn4 A T 7: 28,618,431 (GRCm39) D76E probably benign Het
Afdn A C 17: 14,066,782 (GRCm39) M640L probably benign Het
Angpt1 A T 15: 42,539,837 (GRCm39) F7L probably benign Het
Ap3b2 A G 7: 81,126,092 (GRCm39) F373S probably damaging Het
Armc2 T A 10: 41,800,457 (GRCm39) Y650F probably damaging Het
Atg2b G T 12: 105,630,197 (GRCm39) T398K possibly damaging Het
Baz1a CCATT CCATTCATT 12: 55,021,895 (GRCm39) probably null Het
Capn8 G A 1: 182,438,670 (GRCm39) probably null Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 60,228,130 (GRCm39) probably benign Het
Cfap54 T C 10: 92,637,081 (GRCm39) N3103D probably benign Het
Chd9 G A 8: 91,738,063 (GRCm39) R1565Q unknown Het
Cir1 G A 2: 73,134,152 (GRCm39) T139I probably damaging Het
Cmah T C 13: 24,619,673 (GRCm39) probably null Het
Cnpy1 T C 5: 28,450,800 (GRCm39) D2G probably damaging Het
Dennd4a A T 9: 64,801,793 (GRCm39) T979S probably benign Het
Dnah11 T A 12: 117,842,311 (GRCm39) K4423* probably null Het
Dnajb4 A G 3: 151,892,320 (GRCm39) I171T possibly damaging Het
Dpm1 A T 2: 168,072,307 (GRCm39) probably null Het
Dtwd1 A G 2: 125,996,595 (GRCm39) T27A probably benign Het
Ep400 C T 5: 110,889,872 (GRCm39) D464N unknown Het
Epb42 A T 2: 120,855,091 (GRCm39) I498N probably benign Het
Fhod1 A G 8: 106,064,048 (GRCm39) V219A unknown Het
Gabrb2 A T 11: 42,517,436 (GRCm39) E419D probably benign Het
Galnt18 A T 7: 111,071,168 (GRCm39) N615K possibly damaging Het
Gm29106 T A 1: 118,127,254 (GRCm39) H315Q possibly damaging Het
Gprin2 G T 14: 33,917,615 (GRCm39) Q52K probably benign Het
Grm4 A T 17: 27,657,765 (GRCm39) Y414N probably damaging Het
Gulo C A 14: 66,225,630 (GRCm39) probably null Het
H2-M1 A C 17: 36,980,997 (GRCm39) V313G possibly damaging Het
Hectd3 T C 4: 116,852,951 (GRCm39) W118R probably damaging Het
Hs6st3 G A 14: 120,106,492 (GRCm39) C300Y probably damaging Het
Il1rl2 T A 1: 40,404,519 (GRCm39) S547T possibly damaging Het
Kank1 G T 19: 25,386,872 (GRCm39) V182F probably damaging Het
Kif20b T A 19: 34,928,149 (GRCm39) L1137* probably null Het
Klhl7 A G 5: 24,331,818 (GRCm39) probably null Het
Krt13 T A 11: 100,011,987 (GRCm39) D112V possibly damaging Het
Ltbr A G 6: 125,290,064 (GRCm39) V71A probably benign Het
Ly6g T C 15: 75,030,458 (GRCm39) V92A probably benign Het
Map2k3 G A 11: 60,822,929 (GRCm39) probably benign Het
Mast2 A C 4: 116,168,927 (GRCm39) D842E probably benign Het
Mpo T G 11: 87,694,349 (GRCm39) M693R probably benign Het
Myo15a C A 11: 60,378,234 (GRCm39) S212* probably null Het
Ncapd3 G A 9: 26,974,655 (GRCm39) R709H probably benign Het
Nck2 T A 1: 43,572,892 (GRCm39) Y55* probably null Het
Neurl4 A G 11: 69,798,301 (GRCm39) D777G probably damaging Het
Npr2 G A 4: 43,633,527 (GRCm39) V224M possibly damaging Het
Nptx2 T A 5: 144,484,950 (GRCm39) S148T probably benign Het
Nr1d1 T C 11: 98,661,160 (GRCm39) T369A probably benign Het
Nub1 T G 5: 24,908,483 (GRCm39) F411V probably damaging Het
Nup188 T A 2: 30,194,300 (GRCm39) Y158N probably damaging Het
Or2d36 A T 7: 106,746,660 (GRCm39) I46F probably benign Het
Or5e1 A G 7: 108,354,639 (GRCm39) N192S probably benign Het
Or5m8 A G 2: 85,823,091 (GRCm39) Y310C probably benign Het
Or6c6c A T 10: 129,541,208 (GRCm39) I154F probably damaging Het
Or8c19-ps1 T A 9: 38,220,928 (GRCm39) I279K unknown Het
Orc2 C T 1: 58,536,610 (GRCm39) G85S probably damaging Het
Pak1ip1 T A 13: 41,162,743 (GRCm39) V182D probably damaging Het
Parvg T G 15: 84,210,424 (GRCm39) C30W probably benign Het
Pcdha1 T A 18: 37,065,713 (GRCm39) D792E probably benign Het
Ppp1r13b G T 12: 111,800,242 (GRCm39) Q635K probably benign Het
Pramel26 T C 4: 143,536,886 (GRCm39) T482A probably benign Het
Psg16 A G 7: 16,832,086 (GRCm39) I341V probably benign Het
Psme4 C T 11: 30,826,868 (GRCm39) Q1796* probably null Het
Ptn T G 6: 36,692,699 (GRCm39) probably null Het
Rapsn C T 2: 90,875,823 (GRCm39) P400L probably damaging Het
Rasal1 G A 5: 120,800,358 (GRCm39) G207D probably damaging Het
Rdx A G 9: 51,974,878 (GRCm39) I5V probably benign Het
Rpf1 A G 3: 146,223,533 (GRCm39) I105T probably damaging Het
Rps15a A T 7: 117,709,220 (GRCm39) F79I possibly damaging Het
Rwdd2b G A 16: 87,233,641 (GRCm39) P153L probably benign Het
Scaf11 G A 15: 96,318,298 (GRCm39) S422L probably damaging Het
Serpinb3b T A 1: 107,082,403 (GRCm39) E287V possibly damaging Het
Sgta T C 10: 80,887,118 (GRCm39) D49G possibly damaging Het
Sin3a T A 9: 57,025,358 (GRCm39) M1068K probably benign Het
Slc12a9 G A 5: 137,319,671 (GRCm39) R615W probably damaging Het
Slc26a3 T A 12: 31,499,145 (GRCm39) S151T probably benign Het
Slc4a8 C A 15: 100,681,721 (GRCm39) H111N probably damaging Het
Syngr1 G A 15: 79,975,659 (GRCm39) R22K probably benign Het
Tars2 A T 3: 95,662,077 (GRCm39) V25E probably benign Het
Tbx15 A G 3: 99,259,647 (GRCm39) Y506C probably damaging Het
Tgm4 A T 9: 122,875,634 (GRCm39) K162N possibly damaging Het
Tmem253 A G 14: 52,255,439 (GRCm39) E83G probably damaging Het
Trp73 G A 4: 154,165,859 (GRCm39) T118I probably damaging Het
Trpm7 A G 2: 126,664,578 (GRCm39) S934P possibly damaging Het
Ttc23l G A 15: 10,523,729 (GRCm39) S330L probably benign Het
Tub A C 7: 108,624,845 (GRCm39) D199A probably benign Het
Uri1 A C 7: 37,696,110 (GRCm39) probably null Het
Usp16 C T 16: 87,276,120 (GRCm39) A486V probably benign Het
Vmn1r12 A G 6: 57,136,526 (GRCm39) I208V probably benign Het
Vmn2r116 A T 17: 23,620,797 (GRCm39) M844L probably benign Het
Vmn2r13 C T 5: 109,339,773 (GRCm39) probably null Het
Xpnpep1 T C 19: 53,001,892 (GRCm39) D118G probably damaging Het
Zfp111 G A 7: 23,898,067 (GRCm39) P516S possibly damaging Het
Other mutations in Nadk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Nadk2 APN 15 9,103,072 (GRCm39) missense probably damaging 1.00
tabak UTSW 15 9,108,342 (GRCm39) missense probably damaging 0.99
D4043:Nadk2 UTSW 15 9,103,473 (GRCm39) splice site probably benign
PIT4131001:Nadk2 UTSW 15 9,100,232 (GRCm39) frame shift probably null
PIT4142001:Nadk2 UTSW 15 9,100,232 (GRCm39) frame shift probably null
R0347:Nadk2 UTSW 15 9,084,287 (GRCm39) missense probably benign 0.08
R0838:Nadk2 UTSW 15 9,091,322 (GRCm39) missense probably benign 0.00
R0988:Nadk2 UTSW 15 9,103,080 (GRCm39) missense probably damaging 0.99
R1014:Nadk2 UTSW 15 9,091,334 (GRCm39) missense probably damaging 1.00
R1159:Nadk2 UTSW 15 9,106,925 (GRCm39) missense possibly damaging 0.86
R1387:Nadk2 UTSW 15 9,106,870 (GRCm39) missense possibly damaging 0.68
R1861:Nadk2 UTSW 15 9,108,399 (GRCm39) missense probably benign 0.21
R1886:Nadk2 UTSW 15 9,103,446 (GRCm39) missense possibly damaging 0.87
R2354:Nadk2 UTSW 15 9,085,862 (GRCm39) missense probably damaging 1.00
R3623:Nadk2 UTSW 15 9,084,303 (GRCm39) missense probably damaging 1.00
R3624:Nadk2 UTSW 15 9,084,303 (GRCm39) missense probably damaging 1.00
R4642:Nadk2 UTSW 15 9,092,810 (GRCm39) missense possibly damaging 0.64
R4867:Nadk2 UTSW 15 9,098,946 (GRCm39) missense possibly damaging 0.84
R5314:Nadk2 UTSW 15 9,108,401 (GRCm39) missense probably benign 0.04
R7214:Nadk2 UTSW 15 9,108,342 (GRCm39) missense probably damaging 0.99
R7244:Nadk2 UTSW 15 9,083,271 (GRCm39) splice site probably null
R7310:Nadk2 UTSW 15 9,103,469 (GRCm39) critical splice donor site probably null
R7634:Nadk2 UTSW 15 9,092,935 (GRCm39) missense probably benign 0.41
R8310:Nadk2 UTSW 15 9,103,420 (GRCm39) missense probably benign
R8424:Nadk2 UTSW 15 9,083,414 (GRCm39) missense possibly damaging 0.92
R9265:Nadk2 UTSW 15 9,071,774 (GRCm39) missense probably damaging 1.00
R9658:Nadk2 UTSW 15 9,103,449 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTCTCTGTGGTGGCTGATGAA -3'
(R):5'- ACAATCCATTGGTCTCAGTGAGAA -3'

Sequencing Primer
(F):5'- CTGTGGTGGCTGATGAATGCTC -3'
(R):5'- TCTCAGTGAGAAAAGGCTGATCTGC -3'
Posted On 2022-11-14