Incidental Mutation 'R9746:Afdn'
ID 732168
Institutional Source Beutler Lab
Gene Symbol Afdn
Ensembl Gene ENSMUSG00000068036
Gene Name afadin, adherens junction formation factor
Synonyms Mllt4, AF6, S-afadin, Afadin, I-afadin, 5033403D15Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9746 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 13980735-14126059 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 14066782 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 640 (M640L)
Ref Sequence ENSEMBL: ENSMUSP00000118318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000137708] [ENSMUST00000137784] [ENSMUST00000139666] [ENSMUST00000150848] [ENSMUST00000170827]
AlphaFold Q9QZQ1
PDB Structure Solution structure of the FHA domain of mouse Afadin 6 [SOLUTION NMR]
Solution Structure of Ras-binding Domain in Mouse AF-6 Protein [SOLUTION NMR]
Crystal structure of afadin PDZ domain in complex with the C-terminal peptide from nectin-3 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000137708
AA Change: M640L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114485
Gene: ENSMUSG00000068036
AA Change: M640L

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 785 891 4.11e-39 SMART
PDZ 1016 1093 8.07e-19 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
coiled coil region 1409 1447 N/A INTRINSIC
coiled coil region 1523 1563 N/A INTRINSIC
low complexity region 1575 1587 N/A INTRINSIC
coiled coil region 1616 1660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137784
AA Change: M640L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119153
Gene: ENSMUSG00000068036
AA Change: M640L

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 792 898 4.11e-39 SMART
PDZ 1023 1100 8.07e-19 SMART
low complexity region 1316 1325 N/A INTRINSIC
low complexity region 1393 1399 N/A INTRINSIC
coiled coil region 1416 1454 N/A INTRINSIC
coiled coil region 1530 1570 N/A INTRINSIC
low complexity region 1582 1594 N/A INTRINSIC
coiled coil region 1600 1672 N/A INTRINSIC
low complexity region 1699 1713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139666
AA Change: M640L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118318
Gene: ENSMUSG00000068036
AA Change: M640L

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 785 891 4.11e-39 SMART
PDZ 1016 1093 8.07e-19 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
coiled coil region 1409 1447 N/A INTRINSIC
coiled coil region 1523 1563 N/A INTRINSIC
low complexity region 1575 1587 N/A INTRINSIC
coiled coil region 1593 1665 N/A INTRINSIC
low complexity region 1692 1706 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150848
AA Change: M625L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122447
Gene: ENSMUSG00000068036
AA Change: M625L

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 410 462 1.24e-5 SMART
DIL 770 876 4.11e-39 SMART
PDZ 1001 1078 8.07e-19 SMART
low complexity region 1294 1303 N/A INTRINSIC
low complexity region 1371 1377 N/A INTRINSIC
coiled coil region 1394 1432 N/A INTRINSIC
coiled coil region 1508 1548 N/A INTRINSIC
low complexity region 1560 1572 N/A INTRINSIC
coiled coil region 1578 1650 N/A INTRINSIC
low complexity region 1677 1691 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170827
AA Change: M625L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128891
Gene: ENSMUSG00000068036
AA Change: M625L

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 410 462 1.24e-5 SMART
DIL 770 876 4.11e-39 SMART
PDZ 1001 1078 8.07e-19 SMART
low complexity region 1294 1303 N/A INTRINSIC
low complexity region 1371 1377 N/A INTRINSIC
coiled coil region 1394 1432 N/A INTRINSIC
coiled coil region 1508 1548 N/A INTRINSIC
low complexity region 1560 1572 N/A INTRINSIC
coiled coil region 1578 1650 N/A INTRINSIC
low complexity region 1677 1691 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein involved in signaling and organization of cell junctions during embryogenesis. It has also been identified as the fusion partner of acute lymphoblastic leukemia (ALL-1) gene, involved in acute myeloid leukemias with t(6;11)(q27;q23) translocation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene, however, not all have been fully characterized.[provided by RefSeq, May 2011]
PHENOTYPE: Homozygous null mice display embryonic lethality, abnormal ectoderm development including disrupted cell junctions, and absence of the somites, notochord, allantois, and neural folds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,159,598 (GRCm39) H307L probably benign Het
Acnat1 A T 4: 49,450,652 (GRCm39) L153H probably damaging Het
Actn4 A T 7: 28,618,431 (GRCm39) D76E probably benign Het
Angpt1 A T 15: 42,539,837 (GRCm39) F7L probably benign Het
Ap3b2 A G 7: 81,126,092 (GRCm39) F373S probably damaging Het
Armc2 T A 10: 41,800,457 (GRCm39) Y650F probably damaging Het
Atg2b G T 12: 105,630,197 (GRCm39) T398K possibly damaging Het
Baz1a CCATT CCATTCATT 12: 55,021,895 (GRCm39) probably null Het
Capn8 G A 1: 182,438,670 (GRCm39) probably null Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 60,228,130 (GRCm39) probably benign Het
Cfap54 T C 10: 92,637,081 (GRCm39) N3103D probably benign Het
Chd9 G A 8: 91,738,063 (GRCm39) R1565Q unknown Het
Cir1 G A 2: 73,134,152 (GRCm39) T139I probably damaging Het
Cmah T C 13: 24,619,673 (GRCm39) probably null Het
Cnpy1 T C 5: 28,450,800 (GRCm39) D2G probably damaging Het
Dennd4a A T 9: 64,801,793 (GRCm39) T979S probably benign Het
Dnah11 T A 12: 117,842,311 (GRCm39) K4423* probably null Het
Dnajb4 A G 3: 151,892,320 (GRCm39) I171T possibly damaging Het
Dpm1 A T 2: 168,072,307 (GRCm39) probably null Het
Dtwd1 A G 2: 125,996,595 (GRCm39) T27A probably benign Het
Ep400 C T 5: 110,889,872 (GRCm39) D464N unknown Het
Epb42 A T 2: 120,855,091 (GRCm39) I498N probably benign Het
Fhod1 A G 8: 106,064,048 (GRCm39) V219A unknown Het
Gabrb2 A T 11: 42,517,436 (GRCm39) E419D probably benign Het
Galnt18 A T 7: 111,071,168 (GRCm39) N615K possibly damaging Het
Gm29106 T A 1: 118,127,254 (GRCm39) H315Q possibly damaging Het
Gprin2 G T 14: 33,917,615 (GRCm39) Q52K probably benign Het
Grm4 A T 17: 27,657,765 (GRCm39) Y414N probably damaging Het
Gulo C A 14: 66,225,630 (GRCm39) probably null Het
H2-M1 A C 17: 36,980,997 (GRCm39) V313G possibly damaging Het
Hectd3 T C 4: 116,852,951 (GRCm39) W118R probably damaging Het
Hs6st3 G A 14: 120,106,492 (GRCm39) C300Y probably damaging Het
Il1rl2 T A 1: 40,404,519 (GRCm39) S547T possibly damaging Het
Kank1 G T 19: 25,386,872 (GRCm39) V182F probably damaging Het
Kif20b T A 19: 34,928,149 (GRCm39) L1137* probably null Het
Klhl7 A G 5: 24,331,818 (GRCm39) probably null Het
Krt13 T A 11: 100,011,987 (GRCm39) D112V possibly damaging Het
Ltbr A G 6: 125,290,064 (GRCm39) V71A probably benign Het
Ly6g T C 15: 75,030,458 (GRCm39) V92A probably benign Het
Map2k3 G A 11: 60,822,929 (GRCm39) probably benign Het
Mast2 A C 4: 116,168,927 (GRCm39) D842E probably benign Het
Mpo T G 11: 87,694,349 (GRCm39) M693R probably benign Het
Myo15a C A 11: 60,378,234 (GRCm39) S212* probably null Het
Nadk2 C T 15: 9,106,824 (GRCm39) R37* probably null Het
Ncapd3 G A 9: 26,974,655 (GRCm39) R709H probably benign Het
Nck2 T A 1: 43,572,892 (GRCm39) Y55* probably null Het
Neurl4 A G 11: 69,798,301 (GRCm39) D777G probably damaging Het
Npr2 G A 4: 43,633,527 (GRCm39) V224M possibly damaging Het
Nptx2 T A 5: 144,484,950 (GRCm39) S148T probably benign Het
Nr1d1 T C 11: 98,661,160 (GRCm39) T369A probably benign Het
Nub1 T G 5: 24,908,483 (GRCm39) F411V probably damaging Het
Nup188 T A 2: 30,194,300 (GRCm39) Y158N probably damaging Het
Or2d36 A T 7: 106,746,660 (GRCm39) I46F probably benign Het
Or5e1 A G 7: 108,354,639 (GRCm39) N192S probably benign Het
Or5m8 A G 2: 85,823,091 (GRCm39) Y310C probably benign Het
Or6c6c A T 10: 129,541,208 (GRCm39) I154F probably damaging Het
Or8c19-ps1 T A 9: 38,220,928 (GRCm39) I279K unknown Het
Orc2 C T 1: 58,536,610 (GRCm39) G85S probably damaging Het
Pak1ip1 T A 13: 41,162,743 (GRCm39) V182D probably damaging Het
Parvg T G 15: 84,210,424 (GRCm39) C30W probably benign Het
Pcdha1 T A 18: 37,065,713 (GRCm39) D792E probably benign Het
Ppp1r13b G T 12: 111,800,242 (GRCm39) Q635K probably benign Het
Pramel26 T C 4: 143,536,886 (GRCm39) T482A probably benign Het
Psg16 A G 7: 16,832,086 (GRCm39) I341V probably benign Het
Psme4 C T 11: 30,826,868 (GRCm39) Q1796* probably null Het
Ptn T G 6: 36,692,699 (GRCm39) probably null Het
Rapsn C T 2: 90,875,823 (GRCm39) P400L probably damaging Het
Rasal1 G A 5: 120,800,358 (GRCm39) G207D probably damaging Het
Rdx A G 9: 51,974,878 (GRCm39) I5V probably benign Het
Rpf1 A G 3: 146,223,533 (GRCm39) I105T probably damaging Het
Rps15a A T 7: 117,709,220 (GRCm39) F79I possibly damaging Het
Rwdd2b G A 16: 87,233,641 (GRCm39) P153L probably benign Het
Scaf11 G A 15: 96,318,298 (GRCm39) S422L probably damaging Het
Serpinb3b T A 1: 107,082,403 (GRCm39) E287V possibly damaging Het
Sgta T C 10: 80,887,118 (GRCm39) D49G possibly damaging Het
Sin3a T A 9: 57,025,358 (GRCm39) M1068K probably benign Het
Slc12a9 G A 5: 137,319,671 (GRCm39) R615W probably damaging Het
Slc26a3 T A 12: 31,499,145 (GRCm39) S151T probably benign Het
Slc4a8 C A 15: 100,681,721 (GRCm39) H111N probably damaging Het
Syngr1 G A 15: 79,975,659 (GRCm39) R22K probably benign Het
Tars2 A T 3: 95,662,077 (GRCm39) V25E probably benign Het
Tbx15 A G 3: 99,259,647 (GRCm39) Y506C probably damaging Het
Tgm4 A T 9: 122,875,634 (GRCm39) K162N possibly damaging Het
Tmem253 A G 14: 52,255,439 (GRCm39) E83G probably damaging Het
Trp73 G A 4: 154,165,859 (GRCm39) T118I probably damaging Het
Trpm7 A G 2: 126,664,578 (GRCm39) S934P possibly damaging Het
Ttc23l G A 15: 10,523,729 (GRCm39) S330L probably benign Het
Tub A C 7: 108,624,845 (GRCm39) D199A probably benign Het
Uri1 A C 7: 37,696,110 (GRCm39) probably null Het
Usp16 C T 16: 87,276,120 (GRCm39) A486V probably benign Het
Vmn1r12 A G 6: 57,136,526 (GRCm39) I208V probably benign Het
Vmn2r116 A T 17: 23,620,797 (GRCm39) M844L probably benign Het
Vmn2r13 C T 5: 109,339,773 (GRCm39) probably null Het
Xpnpep1 T C 19: 53,001,892 (GRCm39) D118G probably damaging Het
Zfp111 G A 7: 23,898,067 (GRCm39) P516S possibly damaging Het
Other mutations in Afdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Afdn APN 17 14,104,890 (GRCm39) missense probably damaging 1.00
IGL00784:Afdn APN 17 14,069,525 (GRCm39) splice site probably benign
IGL00971:Afdn APN 17 14,072,575 (GRCm39) splice site probably benign
IGL01403:Afdn APN 17 14,124,132 (GRCm39) missense probably damaging 1.00
IGL01944:Afdn APN 17 14,030,743 (GRCm39) missense probably damaging 1.00
IGL02474:Afdn APN 17 14,038,491 (GRCm39) missense probably damaging 1.00
IGL02615:Afdn APN 17 14,046,238 (GRCm39) missense probably benign 0.00
IGL02664:Afdn APN 17 14,072,728 (GRCm39) splice site probably benign
IGL03036:Afdn APN 17 14,108,350 (GRCm39) missense probably benign 0.12
jubilee UTSW 17 14,108,248 (GRCm39) missense probably damaging 1.00
IGL03134:Afdn UTSW 17 14,066,548 (GRCm39) missense probably benign 0.04
R0112:Afdn UTSW 17 14,104,899 (GRCm39) missense probably damaging 1.00
R0226:Afdn UTSW 17 14,119,408 (GRCm39) missense probably benign 0.00
R0305:Afdn UTSW 17 14,108,776 (GRCm39) splice site probably null
R0310:Afdn UTSW 17 14,105,770 (GRCm39) critical splice donor site probably null
R0711:Afdn UTSW 17 14,072,698 (GRCm39) missense probably damaging 1.00
R0828:Afdn UTSW 17 14,124,260 (GRCm39) missense probably damaging 1.00
R1268:Afdn UTSW 17 14,108,248 (GRCm39) missense probably damaging 1.00
R1317:Afdn UTSW 17 14,066,535 (GRCm39) missense probably benign 0.11
R1386:Afdn UTSW 17 14,066,798 (GRCm39) missense probably damaging 1.00
R1438:Afdn UTSW 17 14,075,652 (GRCm39) missense probably damaging 1.00
R1607:Afdn UTSW 17 14,030,763 (GRCm39) missense probably damaging 1.00
R1819:Afdn UTSW 17 14,071,110 (GRCm39) missense probably damaging 1.00
R1872:Afdn UTSW 17 14,101,578 (GRCm39) missense probably damaging 1.00
R1880:Afdn UTSW 17 14,072,615 (GRCm39) missense possibly damaging 0.84
R2049:Afdn UTSW 17 14,030,695 (GRCm39) missense probably damaging 0.96
R2140:Afdn UTSW 17 14,030,695 (GRCm39) missense probably damaging 0.96
R2142:Afdn UTSW 17 14,030,695 (GRCm39) missense probably damaging 0.96
R2162:Afdn UTSW 17 14,116,436 (GRCm39) missense probably benign 0.01
R2221:Afdn UTSW 17 14,103,999 (GRCm39) splice site probably benign
R2223:Afdn UTSW 17 14,103,999 (GRCm39) splice site probably benign
R2291:Afdn UTSW 17 14,109,153 (GRCm39) missense probably damaging 1.00
R2993:Afdn UTSW 17 14,111,262 (GRCm39) critical splice donor site probably null
R3402:Afdn UTSW 17 14,104,176 (GRCm39) missense probably damaging 1.00
R3403:Afdn UTSW 17 14,104,176 (GRCm39) missense probably damaging 1.00
R3690:Afdn UTSW 17 14,108,671 (GRCm39) missense probably damaging 1.00
R3691:Afdn UTSW 17 14,108,671 (GRCm39) missense probably damaging 1.00
R3764:Afdn UTSW 17 14,066,851 (GRCm39) missense probably benign 0.07
R3832:Afdn UTSW 17 14,116,436 (GRCm39) missense probably benign 0.01
R4002:Afdn UTSW 17 14,104,179 (GRCm39) missense probably damaging 1.00
R4440:Afdn UTSW 17 14,071,152 (GRCm39) missense probably damaging 1.00
R4621:Afdn UTSW 17 14,109,082 (GRCm39) missense probably damaging 1.00
R4935:Afdn UTSW 17 14,111,228 (GRCm39) missense probably benign 0.30
R5279:Afdn UTSW 17 14,109,214 (GRCm39) missense probably damaging 1.00
R5421:Afdn UTSW 17 14,052,668 (GRCm39) missense probably benign 0.25
R5689:Afdn UTSW 17 14,075,621 (GRCm39) missense probably damaging 1.00
R6332:Afdn UTSW 17 14,030,707 (GRCm39) missense possibly damaging 0.92
R6369:Afdn UTSW 17 14,055,605 (GRCm39) nonsense probably null
R6433:Afdn UTSW 17 14,101,561 (GRCm39) missense probably damaging 1.00
R6467:Afdn UTSW 17 14,024,315 (GRCm39) missense probably damaging 1.00
R6500:Afdn UTSW 17 14,042,634 (GRCm39) missense possibly damaging 0.67
R6564:Afdn UTSW 17 14,116,351 (GRCm39) missense probably benign
R6705:Afdn UTSW 17 14,108,283 (GRCm39) missense probably benign 0.01
R6733:Afdn UTSW 17 14,043,615 (GRCm39) missense probably benign 0.39
R6983:Afdn UTSW 17 14,101,583 (GRCm39) missense probably damaging 1.00
R7089:Afdn UTSW 17 14,111,074 (GRCm39) splice site probably null
R7161:Afdn UTSW 17 14,109,208 (GRCm39) missense possibly damaging 0.55
R7175:Afdn UTSW 17 14,108,869 (GRCm39) missense probably damaging 1.00
R7492:Afdn UTSW 17 14,068,638 (GRCm39) critical splice donor site probably null
R7567:Afdn UTSW 17 14,109,070 (GRCm39) missense probably benign 0.19
R7581:Afdn UTSW 17 14,069,500 (GRCm39) missense probably damaging 1.00
R7694:Afdn UTSW 17 14,109,144 (GRCm39) missense probably damaging 0.99
R7722:Afdn UTSW 17 14,029,231 (GRCm39) missense probably benign 0.40
R7794:Afdn UTSW 17 14,102,695 (GRCm39) missense probably damaging 1.00
R8039:Afdn UTSW 17 14,119,403 (GRCm39) missense probably damaging 0.99
R8444:Afdn UTSW 17 14,104,062 (GRCm39) missense probably benign 0.31
R8694:Afdn UTSW 17 14,108,641 (GRCm39) missense probably benign
R8728:Afdn UTSW 17 14,119,207 (GRCm39) missense probably damaging 1.00
R8770:Afdn UTSW 17 14,104,199 (GRCm39) critical splice donor site probably null
R8887:Afdn UTSW 17 14,116,401 (GRCm39) nonsense probably null
R9101:Afdn UTSW 17 14,043,706 (GRCm39) missense probably damaging 0.99
R9169:Afdn UTSW 17 14,072,627 (GRCm39) missense probably benign 0.02
R9275:Afdn UTSW 17 14,024,270 (GRCm39) missense probably damaging 1.00
R9276:Afdn UTSW 17 14,024,270 (GRCm39) missense probably damaging 1.00
R9277:Afdn UTSW 17 14,024,270 (GRCm39) missense probably damaging 1.00
R9278:Afdn UTSW 17 14,024,270 (GRCm39) missense probably damaging 1.00
R9281:Afdn UTSW 17 14,024,270 (GRCm39) missense probably damaging 1.00
R9573:Afdn UTSW 17 14,050,229 (GRCm39) missense probably damaging 1.00
R9619:Afdn UTSW 17 14,101,566 (GRCm39) missense probably damaging 1.00
R9797:Afdn UTSW 17 14,066,562 (GRCm39) missense probably benign
X0060:Afdn UTSW 17 14,038,432 (GRCm39) nonsense probably null
X0064:Afdn UTSW 17 14,108,289 (GRCm39) missense possibly damaging 0.60
Z1088:Afdn UTSW 17 14,104,042 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATACTGCCTGCCAGCATTG -3'
(R):5'- TGTCACAGAAACTAACAAGATGGC -3'

Sequencing Primer
(F):5'- CTGCCAGCATTGAATTCAGG -3'
(R):5'- ATGGCTGCCATCCTCCCAG -3'
Posted On 2022-11-14