Incidental Mutation 'R9746:Afdn'
ID 732168
Institutional Source Beutler Lab
Gene Symbol Afdn
Ensembl Gene ENSMUSG00000068036
Gene Name afadin, adherens junction formation factor
Synonyms Afadin, I-afadin, AF6, Mllt4, S-afadin, 5033403D15Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9746 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 13760539-13906150 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 13846520 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 640 (M640L)
Ref Sequence ENSEMBL: ENSMUSP00000118318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000137708] [ENSMUST00000137784] [ENSMUST00000139666] [ENSMUST00000150848] [ENSMUST00000170827]
AlphaFold Q9QZQ1
PDB Structure Solution structure of the FHA domain of mouse Afadin 6 [SOLUTION NMR]
Solution Structure of Ras-binding Domain in Mouse AF-6 Protein [SOLUTION NMR]
Crystal structure of afadin PDZ domain in complex with the C-terminal peptide from nectin-3 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000137708
AA Change: M640L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114485
Gene: ENSMUSG00000068036
AA Change: M640L

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 785 891 4.11e-39 SMART
PDZ 1016 1093 8.07e-19 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
coiled coil region 1409 1447 N/A INTRINSIC
coiled coil region 1523 1563 N/A INTRINSIC
low complexity region 1575 1587 N/A INTRINSIC
coiled coil region 1616 1660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137784
AA Change: M640L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119153
Gene: ENSMUSG00000068036
AA Change: M640L

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 792 898 4.11e-39 SMART
PDZ 1023 1100 8.07e-19 SMART
low complexity region 1316 1325 N/A INTRINSIC
low complexity region 1393 1399 N/A INTRINSIC
coiled coil region 1416 1454 N/A INTRINSIC
coiled coil region 1530 1570 N/A INTRINSIC
low complexity region 1582 1594 N/A INTRINSIC
coiled coil region 1600 1672 N/A INTRINSIC
low complexity region 1699 1713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139666
AA Change: M640L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118318
Gene: ENSMUSG00000068036
AA Change: M640L

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 785 891 4.11e-39 SMART
PDZ 1016 1093 8.07e-19 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
coiled coil region 1409 1447 N/A INTRINSIC
coiled coil region 1523 1563 N/A INTRINSIC
low complexity region 1575 1587 N/A INTRINSIC
coiled coil region 1593 1665 N/A INTRINSIC
low complexity region 1692 1706 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150848
AA Change: M625L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122447
Gene: ENSMUSG00000068036
AA Change: M625L

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 410 462 1.24e-5 SMART
DIL 770 876 4.11e-39 SMART
PDZ 1001 1078 8.07e-19 SMART
low complexity region 1294 1303 N/A INTRINSIC
low complexity region 1371 1377 N/A INTRINSIC
coiled coil region 1394 1432 N/A INTRINSIC
coiled coil region 1508 1548 N/A INTRINSIC
low complexity region 1560 1572 N/A INTRINSIC
coiled coil region 1578 1650 N/A INTRINSIC
low complexity region 1677 1691 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170827
AA Change: M625L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128891
Gene: ENSMUSG00000068036
AA Change: M625L

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 410 462 1.24e-5 SMART
DIL 770 876 4.11e-39 SMART
PDZ 1001 1078 8.07e-19 SMART
low complexity region 1294 1303 N/A INTRINSIC
low complexity region 1371 1377 N/A INTRINSIC
coiled coil region 1394 1432 N/A INTRINSIC
coiled coil region 1508 1548 N/A INTRINSIC
low complexity region 1560 1572 N/A INTRINSIC
coiled coil region 1578 1650 N/A INTRINSIC
low complexity region 1677 1691 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein involved in signaling and organization of cell junctions during embryogenesis. It has also been identified as the fusion partner of acute lymphoblastic leukemia (ALL-1) gene, involved in acute myeloid leukemias with t(6;11)(q27;q23) translocation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene, however, not all have been fully characterized.[provided by RefSeq, May 2011]
PHENOTYPE: Homozygous null mice display embryonic lethality, abnormal ectoderm development including disrupted cell junctions, and absence of the somites, notochord, allantois, and neural folds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,332,031 H307L probably benign Het
Acnat1 A T 4: 49,450,652 L153H probably damaging Het
Actn4 A T 7: 28,919,006 D76E probably benign Het
Angpt1 A T 15: 42,676,441 F7L probably benign Het
Ap3b2 A G 7: 81,476,344 F373S probably damaging Het
Armc2 T A 10: 41,924,461 Y650F probably damaging Het
Atg2b G T 12: 105,663,938 T398K possibly damaging Het
Baz1a CCATT CCATTCATT 12: 54,975,110 probably null Het
Capn8 G A 1: 182,611,105 probably null Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cfap54 T C 10: 92,801,219 N3103D probably benign Het
Chd9 G A 8: 91,011,435 R1565Q unknown Het
Cir1 G A 2: 73,303,808 T139I probably damaging Het
Cmah T C 13: 24,435,690 probably null Het
Cnpy1 T C 5: 28,245,802 D2G probably damaging Het
Dennd4a A T 9: 64,894,511 T979S probably benign Het
Dnah11 T A 12: 117,878,576 K4423* probably null Het
Dnajb4 A G 3: 152,186,683 I171T possibly damaging Het
Dpm1 A T 2: 168,230,387 probably null Het
Dtwd1 A G 2: 126,154,675 T27A probably benign Het
Ep400 C T 5: 110,742,006 D464N unknown Het
Epb42 A T 2: 121,024,610 I498N probably benign Het
Fhod1 A G 8: 105,337,416 V219A unknown Het
Gabrb2 A T 11: 42,626,609 E419D probably benign Het
Galnt18 A T 7: 111,471,961 N615K possibly damaging Het
Gm13084 T C 4: 143,810,316 T482A probably benign Het
Gm29106 T A 1: 118,199,524 H315Q possibly damaging Het
Gprin2 G T 14: 34,195,658 Q52K probably benign Het
Grm4 A T 17: 27,438,791 Y414N probably damaging Het
Gulo C A 14: 65,988,181 probably null Het
H2-M1 A C 17: 36,670,105 V313G possibly damaging Het
Hectd3 T C 4: 116,995,754 W118R probably damaging Het
Hs6st3 G A 14: 119,869,080 C300Y probably damaging Het
Il1rl2 T A 1: 40,365,359 S547T possibly damaging Het
Kank1 G T 19: 25,409,508 V182F probably damaging Het
Kif20b T A 19: 34,950,749 L1137* probably null Het
Klhl7 A G 5: 24,126,820 probably null Het
Krt13 T A 11: 100,121,161 D112V possibly damaging Het
Ltbr A G 6: 125,313,101 V71A probably benign Het
Ly6g T C 15: 75,158,609 V92A probably benign Het
Map2k3 G A 11: 60,932,103 probably benign Het
Mast2 A C 4: 116,311,730 D842E probably benign Het
Mpo T G 11: 87,803,523 M693R probably benign Het
Myo15 C A 11: 60,487,408 S212* probably null Het
Nadk2 C T 15: 9,106,736 R37* probably null Het
Ncapd3 G A 9: 27,063,359 R709H probably benign Het
Nck2 T A 1: 43,533,732 Y55* probably null Het
Neurl4 A G 11: 69,907,475 D777G probably damaging Het
Npr2 G A 4: 43,633,527 V224M possibly damaging Het
Nptx2 T A 5: 144,548,140 S148T probably benign Het
Nr1d1 T C 11: 98,770,334 T369A probably benign Het
Nub1 T G 5: 24,703,485 F411V probably damaging Het
Nup188 T A 2: 30,304,288 Y158N probably damaging Het
Olfr1031 A G 2: 85,992,747 Y310C probably benign Het
Olfr513 A G 7: 108,755,432 N192S probably benign Het
Olfr716 A T 7: 107,147,453 I46F probably benign Het
Olfr804 A T 10: 129,705,339 I154F probably damaging Het
Olfr897-ps1 T A 9: 38,309,632 I279K unknown Het
Orc2 C T 1: 58,497,451 G85S probably damaging Het
Pak1ip1 T A 13: 41,009,267 V182D probably damaging Het
Parvg T G 15: 84,326,223 C30W probably benign Het
Pcdha1 T A 18: 36,932,660 D792E probably benign Het
Ppp1r13b G T 12: 111,833,808 Q635K probably benign Het
Psg16 A G 7: 17,098,161 I341V probably benign Het
Psme4 C T 11: 30,876,868 Q1796* probably null Het
Ptn T G 6: 36,715,764 probably null Het
Rapsn C T 2: 91,045,478 P400L probably damaging Het
Rasal1 G A 5: 120,662,293 G207D probably damaging Het
Rdx A G 9: 52,063,578 I5V probably benign Het
Rpf1 A G 3: 146,517,778 I105T probably damaging Het
Rps15a A T 7: 118,109,997 F79I possibly damaging Het
Rwdd2b G A 16: 87,436,753 P153L probably benign Het
Scaf11 G A 15: 96,420,417 S422L probably damaging Het
Serpinb3b T A 1: 107,154,673 E287V possibly damaging Het
Sgta T C 10: 81,051,284 D49G possibly damaging Het
Sin3a T A 9: 57,118,074 M1068K probably benign Het
Slc12a9 G A 5: 137,321,409 R615W probably damaging Het
Slc26a3 T A 12: 31,449,146 S151T probably benign Het
Slc4a8 C A 15: 100,783,840 H111N probably damaging Het
Syngr1 G A 15: 80,091,458 R22K probably benign Het
Tars2 A T 3: 95,754,765 V25E probably benign Het
Tbx15 A G 3: 99,352,331 Y506C probably damaging Het
Tgm4 A T 9: 123,046,569 K162N possibly damaging Het
Tmem253 A G 14: 52,017,982 E83G probably damaging Het
Trp73 G A 4: 154,081,402 T118I probably damaging Het
Trpm7 A G 2: 126,822,658 S934P possibly damaging Het
Ttc23l G A 15: 10,523,643 S330L probably benign Het
Tub A C 7: 109,025,638 D199A probably benign Het
Uri1 A C 7: 37,996,685 probably null Het
Usp16 C T 16: 87,479,232 A486V probably benign Het
Vmn1r12 A G 6: 57,159,541 I208V probably benign Het
Vmn2r116 A T 17: 23,401,823 M844L probably benign Het
Vmn2r13 C T 5: 109,191,907 probably null Het
Xpnpep1 T C 19: 53,013,461 D118G probably damaging Het
Zfp111 G A 7: 24,198,642 P516S possibly damaging Het
Other mutations in Afdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Afdn APN 17 13884628 missense probably damaging 1.00
IGL00784:Afdn APN 17 13849263 splice site probably benign
IGL00971:Afdn APN 17 13852313 splice site probably benign
IGL01403:Afdn APN 17 13903870 missense probably damaging 1.00
IGL01944:Afdn APN 17 13810481 missense probably damaging 1.00
IGL02474:Afdn APN 17 13818229 missense probably damaging 1.00
IGL02615:Afdn APN 17 13825976 missense probably benign 0.00
IGL02664:Afdn APN 17 13852466 splice site probably benign
IGL03036:Afdn APN 17 13888088 missense probably benign 0.12
jubilee UTSW 17 13887986 missense probably damaging 1.00
IGL03134:Afdn UTSW 17 13846286 missense probably benign 0.04
R0112:Afdn UTSW 17 13884637 missense probably damaging 1.00
R0226:Afdn UTSW 17 13899146 missense probably benign 0.00
R0305:Afdn UTSW 17 13888514 splice site probably null
R0310:Afdn UTSW 17 13885508 critical splice donor site probably null
R0711:Afdn UTSW 17 13852436 missense probably damaging 1.00
R0828:Afdn UTSW 17 13903998 missense probably damaging 1.00
R1268:Afdn UTSW 17 13887986 missense probably damaging 1.00
R1317:Afdn UTSW 17 13846273 missense probably benign 0.11
R1386:Afdn UTSW 17 13846536 missense probably damaging 1.00
R1438:Afdn UTSW 17 13855390 missense probably damaging 1.00
R1607:Afdn UTSW 17 13810501 missense probably damaging 1.00
R1819:Afdn UTSW 17 13850848 missense probably damaging 1.00
R1872:Afdn UTSW 17 13881316 missense probably damaging 1.00
R1880:Afdn UTSW 17 13852353 missense possibly damaging 0.84
R2049:Afdn UTSW 17 13810433 missense probably damaging 0.96
R2140:Afdn UTSW 17 13810433 missense probably damaging 0.96
R2142:Afdn UTSW 17 13810433 missense probably damaging 0.96
R2162:Afdn UTSW 17 13896174 missense probably benign 0.01
R2221:Afdn UTSW 17 13883737 splice site probably benign
R2223:Afdn UTSW 17 13883737 splice site probably benign
R2291:Afdn UTSW 17 13888891 missense probably damaging 1.00
R2993:Afdn UTSW 17 13891000 critical splice donor site probably null
R3402:Afdn UTSW 17 13883914 missense probably damaging 1.00
R3403:Afdn UTSW 17 13883914 missense probably damaging 1.00
R3690:Afdn UTSW 17 13888409 missense probably damaging 1.00
R3691:Afdn UTSW 17 13888409 missense probably damaging 1.00
R3764:Afdn UTSW 17 13846589 missense probably benign 0.07
R3832:Afdn UTSW 17 13896174 missense probably benign 0.01
R4002:Afdn UTSW 17 13883917 missense probably damaging 1.00
R4440:Afdn UTSW 17 13850890 missense probably damaging 1.00
R4621:Afdn UTSW 17 13888820 missense probably damaging 1.00
R4935:Afdn UTSW 17 13890966 missense probably benign 0.30
R5279:Afdn UTSW 17 13888952 missense probably damaging 1.00
R5421:Afdn UTSW 17 13832406 missense probably benign 0.25
R5689:Afdn UTSW 17 13855359 missense probably damaging 1.00
R6332:Afdn UTSW 17 13810445 missense possibly damaging 0.92
R6369:Afdn UTSW 17 13835343 nonsense probably null
R6433:Afdn UTSW 17 13881299 missense probably damaging 1.00
R6467:Afdn UTSW 17 13804053 missense probably damaging 1.00
R6500:Afdn UTSW 17 13822372 missense possibly damaging 0.67
R6564:Afdn UTSW 17 13896089 missense probably benign
R6705:Afdn UTSW 17 13888021 missense probably benign 0.01
R6733:Afdn UTSW 17 13823353 missense probably benign 0.39
R6983:Afdn UTSW 17 13881321 missense probably damaging 1.00
R7089:Afdn UTSW 17 13890812 splice site probably null
R7161:Afdn UTSW 17 13888946 missense possibly damaging 0.55
R7175:Afdn UTSW 17 13888607 missense probably damaging 1.00
R7492:Afdn UTSW 17 13848376 critical splice donor site probably null
R7567:Afdn UTSW 17 13888808 missense probably benign 0.19
R7581:Afdn UTSW 17 13849238 missense probably damaging 1.00
R7694:Afdn UTSW 17 13888882 missense probably damaging 0.99
R7722:Afdn UTSW 17 13808969 missense probably benign 0.40
R7794:Afdn UTSW 17 13882433 missense probably damaging 1.00
R8039:Afdn UTSW 17 13899141 missense probably damaging 0.99
R8444:Afdn UTSW 17 13883800 missense probably benign 0.31
R8694:Afdn UTSW 17 13888379 missense probably benign
R8728:Afdn UTSW 17 13898945 missense probably damaging 1.00
R8770:Afdn UTSW 17 13883937 critical splice donor site probably null
R8887:Afdn UTSW 17 13896139 nonsense probably null
R9101:Afdn UTSW 17 13823444 missense probably damaging 0.99
R9169:Afdn UTSW 17 13852365 missense probably benign 0.02
R9275:Afdn UTSW 17 13804008 missense probably damaging 1.00
R9276:Afdn UTSW 17 13804008 missense probably damaging 1.00
R9277:Afdn UTSW 17 13804008 missense probably damaging 1.00
R9278:Afdn UTSW 17 13804008 missense probably damaging 1.00
R9281:Afdn UTSW 17 13804008 missense probably damaging 1.00
R9573:Afdn UTSW 17 13829967 missense probably damaging 1.00
R9619:Afdn UTSW 17 13881304 missense probably damaging 1.00
R9797:Afdn UTSW 17 13846300 missense probably benign
X0060:Afdn UTSW 17 13818170 nonsense probably null
X0064:Afdn UTSW 17 13888027 missense possibly damaging 0.60
Z1088:Afdn UTSW 17 13883780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATACTGCCTGCCAGCATTG -3'
(R):5'- TGTCACAGAAACTAACAAGATGGC -3'

Sequencing Primer
(F):5'- CTGCCAGCATTGAATTCAGG -3'
(R):5'- ATGGCTGCCATCCTCCCAG -3'
Posted On 2022-11-14