Incidental Mutation 'R9746:Vmn2r116'
ID 732169
Institutional Source Beutler Lab
Gene Symbol Vmn2r116
Ensembl Gene ENSMUSG00000090966
Gene Name vomeronasal 2, receptor 116
Synonyms V2Rp5, EG619697
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R9746 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 23384803-23401864 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 23401823 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 844 (M844L)
Ref Sequence ENSEMBL: ENSMUSP00000128106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164856]
AlphaFold E9Q6I0
Predicted Effect probably benign
Transcript: ENSMUST00000164856
AA Change: M844L

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000128106
Gene: ENSMUSG00000090966
AA Change: M844L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 4.4e-30 PFAM
Pfam:NCD3G 511 564 1.2e-22 PFAM
low complexity region 589 594 N/A INTRINSIC
Pfam:7tm_3 595 832 8.7e-57 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Female mice homozygous for a knock-out allele stimulated with male pheromone (Gm6084) fail to exhibit an increase in lordosis behavior and successful intromission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,332,031 H307L probably benign Het
Acnat1 A T 4: 49,450,652 L153H probably damaging Het
Actn4 A T 7: 28,919,006 D76E probably benign Het
Afdn A C 17: 13,846,520 M640L probably benign Het
Angpt1 A T 15: 42,676,441 F7L probably benign Het
Ap3b2 A G 7: 81,476,344 F373S probably damaging Het
Armc2 T A 10: 41,924,461 Y650F probably damaging Het
Atg2b G T 12: 105,663,938 T398K possibly damaging Het
Baz1a CCATT CCATTCATT 12: 54,975,110 probably null Het
Capn8 G A 1: 182,611,105 probably null Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cfap54 T C 10: 92,801,219 N3103D probably benign Het
Chd9 G A 8: 91,011,435 R1565Q unknown Het
Cir1 G A 2: 73,303,808 T139I probably damaging Het
Cmah T C 13: 24,435,690 probably null Het
Cnpy1 T C 5: 28,245,802 D2G probably damaging Het
Dennd4a A T 9: 64,894,511 T979S probably benign Het
Dnah11 T A 12: 117,878,576 K4423* probably null Het
Dnajb4 A G 3: 152,186,683 I171T possibly damaging Het
Dpm1 A T 2: 168,230,387 probably null Het
Dtwd1 A G 2: 126,154,675 T27A probably benign Het
Ep400 C T 5: 110,742,006 D464N unknown Het
Epb42 A T 2: 121,024,610 I498N probably benign Het
Fhod1 A G 8: 105,337,416 V219A unknown Het
Gabrb2 A T 11: 42,626,609 E419D probably benign Het
Galnt18 A T 7: 111,471,961 N615K possibly damaging Het
Gm13084 T C 4: 143,810,316 T482A probably benign Het
Gm29106 T A 1: 118,199,524 H315Q possibly damaging Het
Gprin2 G T 14: 34,195,658 Q52K probably benign Het
Grm4 A T 17: 27,438,791 Y414N probably damaging Het
Gulo C A 14: 65,988,181 probably null Het
H2-M1 A C 17: 36,670,105 V313G possibly damaging Het
Hectd3 T C 4: 116,995,754 W118R probably damaging Het
Hs6st3 G A 14: 119,869,080 C300Y probably damaging Het
Il1rl2 T A 1: 40,365,359 S547T possibly damaging Het
Kank1 G T 19: 25,409,508 V182F probably damaging Het
Kif20b T A 19: 34,950,749 L1137* probably null Het
Klhl7 A G 5: 24,126,820 probably null Het
Krt13 T A 11: 100,121,161 D112V possibly damaging Het
Ltbr A G 6: 125,313,101 V71A probably benign Het
Ly6g T C 15: 75,158,609 V92A probably benign Het
Map2k3 G A 11: 60,932,103 probably benign Het
Mast2 A C 4: 116,311,730 D842E probably benign Het
Mpo T G 11: 87,803,523 M693R probably benign Het
Myo15 C A 11: 60,487,408 S212* probably null Het
Nadk2 C T 15: 9,106,736 R37* probably null Het
Ncapd3 G A 9: 27,063,359 R709H probably benign Het
Nck2 T A 1: 43,533,732 Y55* probably null Het
Neurl4 A G 11: 69,907,475 D777G probably damaging Het
Npr2 G A 4: 43,633,527 V224M possibly damaging Het
Nptx2 T A 5: 144,548,140 S148T probably benign Het
Nr1d1 T C 11: 98,770,334 T369A probably benign Het
Nub1 T G 5: 24,703,485 F411V probably damaging Het
Nup188 T A 2: 30,304,288 Y158N probably damaging Het
Olfr1031 A G 2: 85,992,747 Y310C probably benign Het
Olfr513 A G 7: 108,755,432 N192S probably benign Het
Olfr716 A T 7: 107,147,453 I46F probably benign Het
Olfr804 A T 10: 129,705,339 I154F probably damaging Het
Olfr897-ps1 T A 9: 38,309,632 I279K unknown Het
Orc2 C T 1: 58,497,451 G85S probably damaging Het
Pak1ip1 T A 13: 41,009,267 V182D probably damaging Het
Parvg T G 15: 84,326,223 C30W probably benign Het
Pcdha1 T A 18: 36,932,660 D792E probably benign Het
Ppp1r13b G T 12: 111,833,808 Q635K probably benign Het
Psg16 A G 7: 17,098,161 I341V probably benign Het
Psme4 C T 11: 30,876,868 Q1796* probably null Het
Ptn T G 6: 36,715,764 probably null Het
Rapsn C T 2: 91,045,478 P400L probably damaging Het
Rasal1 G A 5: 120,662,293 G207D probably damaging Het
Rdx A G 9: 52,063,578 I5V probably benign Het
Rpf1 A G 3: 146,517,778 I105T probably damaging Het
Rps15a A T 7: 118,109,997 F79I possibly damaging Het
Rwdd2b G A 16: 87,436,753 P153L probably benign Het
Scaf11 G A 15: 96,420,417 S422L probably damaging Het
Serpinb3b T A 1: 107,154,673 E287V possibly damaging Het
Sgta T C 10: 81,051,284 D49G possibly damaging Het
Sin3a T A 9: 57,118,074 M1068K probably benign Het
Slc12a9 G A 5: 137,321,409 R615W probably damaging Het
Slc26a3 T A 12: 31,449,146 S151T probably benign Het
Slc4a8 C A 15: 100,783,840 H111N probably damaging Het
Syngr1 G A 15: 80,091,458 R22K probably benign Het
Tars2 A T 3: 95,754,765 V25E probably benign Het
Tbx15 A G 3: 99,352,331 Y506C probably damaging Het
Tgm4 A T 9: 123,046,569 K162N possibly damaging Het
Tmem253 A G 14: 52,017,982 E83G probably damaging Het
Trp73 G A 4: 154,081,402 T118I probably damaging Het
Trpm7 A G 2: 126,822,658 S934P possibly damaging Het
Ttc23l G A 15: 10,523,643 S330L probably benign Het
Tub A C 7: 109,025,638 D199A probably benign Het
Uri1 A C 7: 37,996,685 probably null Het
Usp16 C T 16: 87,479,232 A486V probably benign Het
Vmn1r12 A G 6: 57,159,541 I208V probably benign Het
Vmn2r13 C T 5: 109,191,907 probably null Het
Xpnpep1 T C 19: 53,013,461 D118G probably damaging Het
Zfp111 G A 7: 24,198,642 P516S possibly damaging Het
Other mutations in Vmn2r116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Vmn2r116 APN 17 23385995 missense possibly damaging 0.94
IGL00985:Vmn2r116 APN 17 23401515 missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23397727 missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23387236 missense probably benign 0.12
IGL01383:Vmn2r116 APN 17 23401601 missense probably damaging 1.00
IGL01459:Vmn2r116 APN 17 23384929 missense probably damaging 1.00
IGL01725:Vmn2r116 APN 17 23386645 missense probably damaging 1.00
IGL02125:Vmn2r116 APN 17 23397627 splice site probably benign
IGL02170:Vmn2r116 APN 17 23384933 missense probably benign
IGL02209:Vmn2r116 APN 17 23388787 missense probably damaging 1.00
IGL02226:Vmn2r116 APN 17 23384834 missense probably null
IGL02272:Vmn2r116 APN 17 23385999 missense probably benign 0.06
IGL02272:Vmn2r116 APN 17 23386004 missense probably damaging 1.00
IGL02403:Vmn2r116 APN 17 23387364 missense probably damaging 1.00
IGL02686:Vmn2r116 APN 17 23388793 missense probably damaging 0.99
IGL02750:Vmn2r116 APN 17 23397634 splice site probably benign
IGL02977:Vmn2r116 APN 17 23388774 missense possibly damaging 0.90
PIT4449001:Vmn2r116 UTSW 17 23388947 missense probably benign 0.41
R0015:Vmn2r116 UTSW 17 23401849 missense probably benign 0.03
R0219:Vmn2r116 UTSW 17 23386098 nonsense probably null
R0281:Vmn2r116 UTSW 17 23401413 missense possibly damaging 0.90
R0415:Vmn2r116 UTSW 17 23387279 missense possibly damaging 0.55
R0592:Vmn2r116 UTSW 17 23386915 missense probably damaging 0.99
R0610:Vmn2r116 UTSW 17 23387312 missense probably damaging 1.00
R0635:Vmn2r116 UTSW 17 23386887 missense possibly damaging 0.95
R0843:Vmn2r116 UTSW 17 23400960 missense probably benign 0.01
R1329:Vmn2r116 UTSW 17 23387188 missense possibly damaging 0.89
R1396:Vmn2r116 UTSW 17 23386141 missense probably benign
R1401:Vmn2r116 UTSW 17 23386596 splice site probably benign
R1574:Vmn2r116 UTSW 17 23387089 missense probably damaging 0.99
R1574:Vmn2r116 UTSW 17 23387089 missense probably damaging 0.99
R1766:Vmn2r116 UTSW 17 23401766 missense probably damaging 0.98
R2157:Vmn2r116 UTSW 17 23401469 missense probably damaging 1.00
R3622:Vmn2r116 UTSW 17 23386051 missense probably benign 0.11
R3690:Vmn2r116 UTSW 17 23384824 missense unknown
R4298:Vmn2r116 UTSW 17 23401827 missense possibly damaging 0.69
R4373:Vmn2r116 UTSW 17 23401421 missense probably benign 0.01
R4860:Vmn2r116 UTSW 17 23401803 missense probably benign
R4941:Vmn2r116 UTSW 17 23401142 missense probably damaging 1.00
R5119:Vmn2r116 UTSW 17 23387164 missense probably benign 0.01
R5503:Vmn2r116 UTSW 17 23386804 missense probably benign 0.07
R5510:Vmn2r116 UTSW 17 23386121 missense probably damaging 1.00
R5538:Vmn2r116 UTSW 17 23401067 missense probably benign 0.00
R5689:Vmn2r116 UTSW 17 23397719 missense probably benign 0.30
R5765:Vmn2r116 UTSW 17 23401404 missense probably damaging 0.99
R5794:Vmn2r116 UTSW 17 23385968 missense probably damaging 0.99
R5807:Vmn2r116 UTSW 17 23387307 missense probably damaging 1.00
R5837:Vmn2r116 UTSW 17 23387080 missense probably damaging 1.00
R6262:Vmn2r116 UTSW 17 23387377 missense probably benign 0.03
R6298:Vmn2r116 UTSW 17 23386762 missense probably damaging 1.00
R6651:Vmn2r116 UTSW 17 23388831 nonsense probably null
R6667:Vmn2r116 UTSW 17 23401092 missense probably damaging 1.00
R7393:Vmn2r116 UTSW 17 23386125 missense probably benign 0.14
R7571:Vmn2r116 UTSW 17 23384856 splice site probably null
R7940:Vmn2r116 UTSW 17 23386972 missense probably damaging 0.99
R8510:Vmn2r116 UTSW 17 23385931 nonsense probably null
R8950:Vmn2r116 UTSW 17 23401493 missense probably damaging 1.00
R8956:Vmn2r116 UTSW 17 23386762 missense probably damaging 1.00
R8977:Vmn2r116 UTSW 17 23386942 missense possibly damaging 0.56
R9030:Vmn2r116 UTSW 17 23384890 missense possibly damaging 0.82
R9077:Vmn2r116 UTSW 17 23385982 missense probably benign 0.14
R9223:Vmn2r116 UTSW 17 23401167 missense probably damaging 1.00
R9401:Vmn2r116 UTSW 17 23401592 missense probably damaging 1.00
R9449:Vmn2r116 UTSW 17 23386945 missense probably benign 0.01
R9755:Vmn2r116 UTSW 17 23401091 missense probably damaging 1.00
R9759:Vmn2r116 UTSW 17 23401386 missense possibly damaging 0.90
R9800:Vmn2r116 UTSW 17 23401425 missense probably damaging 0.97
S24628:Vmn2r116 UTSW 17 23387279 missense possibly damaging 0.55
Z1176:Vmn2r116 UTSW 17 23401428 missense probably damaging 1.00
Z1177:Vmn2r116 UTSW 17 23388892 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTGGTGCCTTTAATGAAGCC -3'
(R):5'- GTCAATGGAAATATCAGCAGACATG -3'

Sequencing Primer
(F):5'- CCATAACATTCAGCATGCTGGTG -3'
(R):5'- CAGCAGACATGTTATTGCTAGGC -3'
Posted On 2022-11-14