Incidental Mutation 'R9746:Kank1'
ID 732173
Institutional Source Beutler Lab
Gene Symbol Kank1
Ensembl Gene ENSMUSG00000032702
Gene Name KN motif and ankyrin repeat domains 1
Synonyms Ankrd15, D330024H06Rik, A930031B09Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9746 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 25214339-25411860 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 25386872 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 182 (V182F)
Ref Sequence ENSEMBL: ENSMUSP00000116660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049400] [ENSMUST00000146647]
AlphaFold E9Q238
Predicted Effect probably damaging
Transcript: ENSMUST00000049400
AA Change: V154F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042177
Gene: ENSMUSG00000032702
AA Change: V154F

DomainStartEndE-ValueType
Pfam:KN_motif 30 68 3.3e-24 PFAM
low complexity region 88 105 N/A INTRINSIC
low complexity region 138 148 N/A INTRINSIC
coiled coil region 286 314 N/A INTRINSIC
low complexity region 350 358 N/A INTRINSIC
coiled coil region 362 395 N/A INTRINSIC
coiled coil region 451 494 N/A INTRINSIC
low complexity region 541 556 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Blast:ANK 963 993 7e-10 BLAST
low complexity region 1010 1030 N/A INTRINSIC
low complexity region 1074 1095 N/A INTRINSIC
ANK 1169 1199 3.71e-4 SMART
ANK 1203 1236 2.27e1 SMART
ANK 1241 1270 1.33e-5 SMART
ANK 1274 1306 5.84e-2 SMART
ANK 1308 1336 4.86e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000146647
AA Change: V182F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116660
Gene: ENSMUSG00000032702
AA Change: V182F

DomainStartEndE-ValueType
Pfam:KN_motif 58 96 2e-25 PFAM
low complexity region 116 133 N/A INTRINSIC
low complexity region 166 176 N/A INTRINSIC
coiled coil region 314 342 N/A INTRINSIC
low complexity region 378 386 N/A INTRINSIC
coiled coil region 390 423 N/A INTRINSIC
internal_repeat_1 430 479 3.72e-5 PROSPERO
low complexity region 569 584 N/A INTRINSIC
internal_repeat_1 587 636 3.72e-5 PROSPERO
low complexity region 645 657 N/A INTRINSIC
Blast:ANK 991 1021 4e-10 BLAST
low complexity region 1038 1058 N/A INTRINSIC
low complexity region 1102 1123 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Kank family of proteins, which contain multiple ankyrin repeat domains. This family member functions in cytoskeleton formation by regulating actin polymerization. This gene is a candidate tumor suppressor for renal cell carcinoma. Mutations in this gene cause cerebral palsy spastic quadriplegic type 2, a central nervous system development disorder. A t(5;9) translocation results in fusion of the platelet-derived growth factor receptor beta gene (PDGFRB) on chromosome 5 with this gene in a myeloproliferative neoplasm featuring severe thrombocythemia. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,159,598 (GRCm39) H307L probably benign Het
Acnat1 A T 4: 49,450,652 (GRCm39) L153H probably damaging Het
Actn4 A T 7: 28,618,431 (GRCm39) D76E probably benign Het
Afdn A C 17: 14,066,782 (GRCm39) M640L probably benign Het
Angpt1 A T 15: 42,539,837 (GRCm39) F7L probably benign Het
Ap3b2 A G 7: 81,126,092 (GRCm39) F373S probably damaging Het
Armc2 T A 10: 41,800,457 (GRCm39) Y650F probably damaging Het
Atg2b G T 12: 105,630,197 (GRCm39) T398K possibly damaging Het
Baz1a CCATT CCATTCATT 12: 55,021,895 (GRCm39) probably null Het
Capn8 G A 1: 182,438,670 (GRCm39) probably null Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 60,228,130 (GRCm39) probably benign Het
Cfap54 T C 10: 92,637,081 (GRCm39) N3103D probably benign Het
Chd9 G A 8: 91,738,063 (GRCm39) R1565Q unknown Het
Cir1 G A 2: 73,134,152 (GRCm39) T139I probably damaging Het
Cmah T C 13: 24,619,673 (GRCm39) probably null Het
Cnpy1 T C 5: 28,450,800 (GRCm39) D2G probably damaging Het
Dennd4a A T 9: 64,801,793 (GRCm39) T979S probably benign Het
Dnah11 T A 12: 117,842,311 (GRCm39) K4423* probably null Het
Dnajb4 A G 3: 151,892,320 (GRCm39) I171T possibly damaging Het
Dpm1 A T 2: 168,072,307 (GRCm39) probably null Het
Dtwd1 A G 2: 125,996,595 (GRCm39) T27A probably benign Het
Ep400 C T 5: 110,889,872 (GRCm39) D464N unknown Het
Epb42 A T 2: 120,855,091 (GRCm39) I498N probably benign Het
Fhod1 A G 8: 106,064,048 (GRCm39) V219A unknown Het
Gabrb2 A T 11: 42,517,436 (GRCm39) E419D probably benign Het
Galnt18 A T 7: 111,071,168 (GRCm39) N615K possibly damaging Het
Gm29106 T A 1: 118,127,254 (GRCm39) H315Q possibly damaging Het
Gprin2 G T 14: 33,917,615 (GRCm39) Q52K probably benign Het
Grm4 A T 17: 27,657,765 (GRCm39) Y414N probably damaging Het
Gulo C A 14: 66,225,630 (GRCm39) probably null Het
H2-M1 A C 17: 36,980,997 (GRCm39) V313G possibly damaging Het
Hectd3 T C 4: 116,852,951 (GRCm39) W118R probably damaging Het
Hs6st3 G A 14: 120,106,492 (GRCm39) C300Y probably damaging Het
Il1rl2 T A 1: 40,404,519 (GRCm39) S547T possibly damaging Het
Kif20b T A 19: 34,928,149 (GRCm39) L1137* probably null Het
Klhl7 A G 5: 24,331,818 (GRCm39) probably null Het
Krt13 T A 11: 100,011,987 (GRCm39) D112V possibly damaging Het
Ltbr A G 6: 125,290,064 (GRCm39) V71A probably benign Het
Ly6g T C 15: 75,030,458 (GRCm39) V92A probably benign Het
Map2k3 G A 11: 60,822,929 (GRCm39) probably benign Het
Mast2 A C 4: 116,168,927 (GRCm39) D842E probably benign Het
Mpo T G 11: 87,694,349 (GRCm39) M693R probably benign Het
Myo15a C A 11: 60,378,234 (GRCm39) S212* probably null Het
Nadk2 C T 15: 9,106,824 (GRCm39) R37* probably null Het
Ncapd3 G A 9: 26,974,655 (GRCm39) R709H probably benign Het
Nck2 T A 1: 43,572,892 (GRCm39) Y55* probably null Het
Neurl4 A G 11: 69,798,301 (GRCm39) D777G probably damaging Het
Npr2 G A 4: 43,633,527 (GRCm39) V224M possibly damaging Het
Nptx2 T A 5: 144,484,950 (GRCm39) S148T probably benign Het
Nr1d1 T C 11: 98,661,160 (GRCm39) T369A probably benign Het
Nub1 T G 5: 24,908,483 (GRCm39) F411V probably damaging Het
Nup188 T A 2: 30,194,300 (GRCm39) Y158N probably damaging Het
Or2d36 A T 7: 106,746,660 (GRCm39) I46F probably benign Het
Or5e1 A G 7: 108,354,639 (GRCm39) N192S probably benign Het
Or5m8 A G 2: 85,823,091 (GRCm39) Y310C probably benign Het
Or6c6c A T 10: 129,541,208 (GRCm39) I154F probably damaging Het
Or8c19-ps1 T A 9: 38,220,928 (GRCm39) I279K unknown Het
Orc2 C T 1: 58,536,610 (GRCm39) G85S probably damaging Het
Pak1ip1 T A 13: 41,162,743 (GRCm39) V182D probably damaging Het
Parvg T G 15: 84,210,424 (GRCm39) C30W probably benign Het
Pcdha1 T A 18: 37,065,713 (GRCm39) D792E probably benign Het
Ppp1r13b G T 12: 111,800,242 (GRCm39) Q635K probably benign Het
Pramel26 T C 4: 143,536,886 (GRCm39) T482A probably benign Het
Psg16 A G 7: 16,832,086 (GRCm39) I341V probably benign Het
Psme4 C T 11: 30,826,868 (GRCm39) Q1796* probably null Het
Ptn T G 6: 36,692,699 (GRCm39) probably null Het
Rapsn C T 2: 90,875,823 (GRCm39) P400L probably damaging Het
Rasal1 G A 5: 120,800,358 (GRCm39) G207D probably damaging Het
Rdx A G 9: 51,974,878 (GRCm39) I5V probably benign Het
Rpf1 A G 3: 146,223,533 (GRCm39) I105T probably damaging Het
Rps15a A T 7: 117,709,220 (GRCm39) F79I possibly damaging Het
Rwdd2b G A 16: 87,233,641 (GRCm39) P153L probably benign Het
Scaf11 G A 15: 96,318,298 (GRCm39) S422L probably damaging Het
Serpinb3b T A 1: 107,082,403 (GRCm39) E287V possibly damaging Het
Sgta T C 10: 80,887,118 (GRCm39) D49G possibly damaging Het
Sin3a T A 9: 57,025,358 (GRCm39) M1068K probably benign Het
Slc12a9 G A 5: 137,319,671 (GRCm39) R615W probably damaging Het
Slc26a3 T A 12: 31,499,145 (GRCm39) S151T probably benign Het
Slc4a8 C A 15: 100,681,721 (GRCm39) H111N probably damaging Het
Syngr1 G A 15: 79,975,659 (GRCm39) R22K probably benign Het
Tars2 A T 3: 95,662,077 (GRCm39) V25E probably benign Het
Tbx15 A G 3: 99,259,647 (GRCm39) Y506C probably damaging Het
Tgm4 A T 9: 122,875,634 (GRCm39) K162N possibly damaging Het
Tmem253 A G 14: 52,255,439 (GRCm39) E83G probably damaging Het
Trp73 G A 4: 154,165,859 (GRCm39) T118I probably damaging Het
Trpm7 A G 2: 126,664,578 (GRCm39) S934P possibly damaging Het
Ttc23l G A 15: 10,523,729 (GRCm39) S330L probably benign Het
Tub A C 7: 108,624,845 (GRCm39) D199A probably benign Het
Uri1 A C 7: 37,696,110 (GRCm39) probably null Het
Usp16 C T 16: 87,276,120 (GRCm39) A486V probably benign Het
Vmn1r12 A G 6: 57,136,526 (GRCm39) I208V probably benign Het
Vmn2r116 A T 17: 23,620,797 (GRCm39) M844L probably benign Het
Vmn2r13 C T 5: 109,339,773 (GRCm39) probably null Het
Xpnpep1 T C 19: 53,001,892 (GRCm39) D118G probably damaging Het
Zfp111 G A 7: 23,898,067 (GRCm39) P516S possibly damaging Het
Other mutations in Kank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Kank1 APN 19 25,389,122 (GRCm39) missense probably benign
IGL00435:Kank1 APN 19 25,407,600 (GRCm39) missense probably benign 0.41
IGL01105:Kank1 APN 19 25,401,680 (GRCm39) missense possibly damaging 0.80
IGL01974:Kank1 APN 19 25,387,596 (GRCm39) missense possibly damaging 0.87
IGL02031:Kank1 APN 19 25,388,066 (GRCm39) missense probably benign 0.01
IGL02125:Kank1 APN 19 25,388,067 (GRCm39) missense possibly damaging 0.90
IGL02152:Kank1 APN 19 25,405,536 (GRCm39) missense possibly damaging 0.51
IGL02211:Kank1 APN 19 25,407,702 (GRCm39) missense probably damaging 1.00
IGL02440:Kank1 APN 19 25,410,272 (GRCm39) missense probably damaging 1.00
IGL02448:Kank1 APN 19 25,388,739 (GRCm39) missense probably damaging 1.00
IGL02671:Kank1 APN 19 25,405,459 (GRCm39) missense probably damaging 1.00
IGL03102:Kank1 APN 19 25,403,282 (GRCm39) missense probably damaging 1.00
IGL03259:Kank1 APN 19 25,407,705 (GRCm39) missense probably damaging 1.00
IGL02802:Kank1 UTSW 19 25,388,963 (GRCm39) missense probably damaging 1.00
R0107:Kank1 UTSW 19 25,407,730 (GRCm39) unclassified probably benign
R0190:Kank1 UTSW 19 25,386,647 (GRCm39) missense probably benign 0.00
R0330:Kank1 UTSW 19 25,401,677 (GRCm39) missense probably benign 0.00
R0368:Kank1 UTSW 19 25,387,967 (GRCm39) nonsense probably null
R0399:Kank1 UTSW 19 25,388,606 (GRCm39) missense probably benign 0.00
R0426:Kank1 UTSW 19 25,388,837 (GRCm39) missense probably damaging 1.00
R0483:Kank1 UTSW 19 25,403,357 (GRCm39) unclassified probably benign
R1394:Kank1 UTSW 19 25,405,528 (GRCm39) missense probably damaging 1.00
R1495:Kank1 UTSW 19 25,387,713 (GRCm39) missense probably damaging 0.98
R1681:Kank1 UTSW 19 25,387,668 (GRCm39) missense possibly damaging 0.89
R1698:Kank1 UTSW 19 25,388,681 (GRCm39) missense probably benign 0.11
R1830:Kank1 UTSW 19 25,388,396 (GRCm39) missense probably benign 0.00
R1866:Kank1 UTSW 19 25,388,813 (GRCm39) missense probably benign 0.04
R2138:Kank1 UTSW 19 25,389,117 (GRCm39) missense probably benign 0.00
R2139:Kank1 UTSW 19 25,389,117 (GRCm39) missense probably benign 0.00
R2420:Kank1 UTSW 19 25,387,821 (GRCm39) missense probably damaging 1.00
R3153:Kank1 UTSW 19 25,388,052 (GRCm39) missense possibly damaging 0.89
R4164:Kank1 UTSW 19 25,388,436 (GRCm39) missense probably benign 0.10
R4670:Kank1 UTSW 19 25,387,944 (GRCm39) missense probably benign 0.00
R4685:Kank1 UTSW 19 25,387,398 (GRCm39) missense possibly damaging 0.66
R4843:Kank1 UTSW 19 25,408,371 (GRCm39) missense probably damaging 1.00
R4981:Kank1 UTSW 19 25,388,759 (GRCm39) missense probably benign 0.19
R5189:Kank1 UTSW 19 25,401,545 (GRCm39) missense probably damaging 1.00
R5280:Kank1 UTSW 19 25,388,669 (GRCm39) missense probably benign 0.01
R5330:Kank1 UTSW 19 25,388,693 (GRCm39) missense probably damaging 1.00
R5331:Kank1 UTSW 19 25,388,693 (GRCm39) missense probably damaging 1.00
R5435:Kank1 UTSW 19 25,388,507 (GRCm39) missense probably benign 0.04
R5500:Kank1 UTSW 19 25,401,696 (GRCm39) missense possibly damaging 0.46
R5894:Kank1 UTSW 19 25,401,564 (GRCm39) missense probably damaging 1.00
R6087:Kank1 UTSW 19 25,387,088 (GRCm39) missense probably benign 0.41
R6357:Kank1 UTSW 19 25,388,717 (GRCm39) missense probably benign 0.36
R6490:Kank1 UTSW 19 25,387,449 (GRCm39) missense probably damaging 1.00
R6504:Kank1 UTSW 19 25,405,518 (GRCm39) missense probably damaging 1.00
R6942:Kank1 UTSW 19 25,401,537 (GRCm39) missense possibly damaging 0.88
R7037:Kank1 UTSW 19 25,407,705 (GRCm39) missense probably damaging 1.00
R7405:Kank1 UTSW 19 25,387,683 (GRCm39) nonsense probably null
R7486:Kank1 UTSW 19 25,388,193 (GRCm39) missense probably damaging 0.99
R7602:Kank1 UTSW 19 25,399,525 (GRCm39) missense probably benign 0.01
R7701:Kank1 UTSW 19 25,389,129 (GRCm39) critical splice donor site probably null
R7765:Kank1 UTSW 19 25,388,569 (GRCm39) frame shift probably null
R7766:Kank1 UTSW 19 25,388,569 (GRCm39) frame shift probably null
R7768:Kank1 UTSW 19 25,388,569 (GRCm39) frame shift probably null
R7919:Kank1 UTSW 19 25,408,439 (GRCm39) missense probably damaging 1.00
R7974:Kank1 UTSW 19 25,401,584 (GRCm39) missense probably damaging 1.00
R7978:Kank1 UTSW 19 25,388,569 (GRCm39) frame shift probably null
R8017:Kank1 UTSW 19 25,388,569 (GRCm39) frame shift probably null
R8017:Kank1 UTSW 19 25,388,568 (GRCm39) frame shift probably null
R8020:Kank1 UTSW 19 25,388,569 (GRCm39) frame shift probably null
R8150:Kank1 UTSW 19 25,388,163 (GRCm39) missense possibly damaging 0.88
R8322:Kank1 UTSW 19 25,355,842 (GRCm39) start gained probably benign
R8374:Kank1 UTSW 19 25,389,005 (GRCm39) missense probably damaging 0.97
R8705:Kank1 UTSW 19 25,388,907 (GRCm39) missense probably damaging 1.00
R8855:Kank1 UTSW 19 25,388,702 (GRCm39) missense possibly damaging 0.87
R8866:Kank1 UTSW 19 25,388,702 (GRCm39) missense possibly damaging 0.87
R8891:Kank1 UTSW 19 25,387,439 (GRCm39) missense probably benign 0.32
R8894:Kank1 UTSW 19 25,408,378 (GRCm39) missense probably damaging 1.00
R8917:Kank1 UTSW 19 25,386,928 (GRCm39) missense probably damaging 0.99
R9217:Kank1 UTSW 19 25,386,944 (GRCm39) missense possibly damaging 0.92
R9301:Kank1 UTSW 19 25,388,798 (GRCm39) missense probably benign 0.00
R9431:Kank1 UTSW 19 25,387,866 (GRCm39) missense probably damaging 1.00
R9603:Kank1 UTSW 19 25,408,289 (GRCm39) missense possibly damaging 0.95
R9680:Kank1 UTSW 19 25,388,138 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACTTCCACTGAGTCTCTGTC -3'
(R):5'- CATTGCCTTGGTAGCCATTCTG -3'

Sequencing Primer
(F):5'- TGTCATCCTCCAACAGTGATGAC -3'
(R):5'- CTGAAGCTGGTGTATTGCAGAAC -3'
Posted On 2022-11-14