Mutagenetix > Incidental Mutation

Incidental Mutation 'R9746:Kank1'

732173

Institutional Source

Beutler Lab

Gene Symbol

Kank1

Ensembl Gene

ENSMUSG00000032702

Gene Name

KN motif and ankyrin repeat domains 1

Synonyms

D330024H06Rik, Ankrd15, A930031B09Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9746 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

25236975-25434496 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 25409508 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 182 (V182F)

Ref Sequence

ENSEMBL: ENSMUSP00000116660 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049400] [ENSMUST00000146647]

AlphaFold

E9Q238

Predicted Effect

probably damaging
Transcript: ENSMUST00000049400
AA Change: V154F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000042177
Gene: ENSMUSG00000032702
AA Change: V154F

Domain	Start	End	E-Value	Type
Pfam:KN_motif	30	68	3.3e-24	PFAM
low complexity region	88	105	N/A	INTRINSIC
low complexity region	138	148	N/A	INTRINSIC
coiled coil region	286	314	N/A	INTRINSIC
low complexity region	350	358	N/A	INTRINSIC
coiled coil region	362	395	N/A	INTRINSIC
coiled coil region	451	494	N/A	INTRINSIC
low complexity region	541	556	N/A	INTRINSIC
low complexity region	617	629	N/A	INTRINSIC
Blast:ANK	963	993	7e-10	BLAST
low complexity region	1010	1030	N/A	INTRINSIC
low complexity region	1074	1095	N/A	INTRINSIC
ANK	1169	1199	3.71e-4	SMART
ANK	1203	1236	2.27e1	SMART
ANK	1241	1270	1.33e-5	SMART
ANK	1274	1306	5.84e-2	SMART
ANK	1308	1336	4.86e1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000146647
AA Change: V182F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116660
Gene: ENSMUSG00000032702
AA Change: V182F

Domain	Start	End	E-Value	Type
Pfam:KN_motif	58	96	2e-25	PFAM
low complexity region	116	133	N/A	INTRINSIC
low complexity region	166	176	N/A	INTRINSIC
coiled coil region	314	342	N/A	INTRINSIC
low complexity region	378	386	N/A	INTRINSIC
coiled coil region	390	423	N/A	INTRINSIC
internal_repeat_1	430	479	3.72e-5	PROSPERO
low complexity region	569	584	N/A	INTRINSIC
internal_repeat_1	587	636	3.72e-5	PROSPERO
low complexity region	645	657	N/A	INTRINSIC
Blast:ANK	991	1021	4e-10	BLAST
low complexity region	1038	1058	N/A	INTRINSIC
low complexity region	1102	1123	N/A	INTRINSIC

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 99.2%
20x: 98.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Kank family of proteins, which contain multiple ankyrin repeat domains. This family member functions in cytoskeleton formation by regulating actin polymerization. This gene is a candidate tumor suppressor for renal cell carcinoma. Mutations in this gene cause cerebral palsy spastic quadriplegic type 2, a central nervous system development disorder. A t(5;9) translocation results in fusion of the platelet-derived growth factor receptor beta gene (PDGFRB) on chromosome 5 with this gene in a myeloproliferative neoplasm featuring severe thrombocythemia. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2014]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ackr1	T	A	1: 173,332,031	H307L	probably benign	Het
Acnat1	A	T	4: 49,450,652	L153H	probably damaging	Het
Actn4	A	T	7: 28,919,006	D76E	probably benign	Het
Afdn	A	C	17: 13,846,520	M640L	probably benign	Het
Angpt1	A	T	15: 42,676,441	F7L	probably benign	Het
Ap3b2	A	G	7: 81,476,344	F373S	probably damaging	Het
Armc2	T	A	10: 41,924,461	Y650F	probably damaging	Het
Atg2b	G	T	12: 105,663,938	T398K	possibly damaging	Het
Baz1a	CCATT	CCATTCATT	12: 54,975,110		probably null	Het
Capn8	G	A	1: 182,611,105		probably null	Het
Cdr1	AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC	AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC	X: 61,184,524		probably benign	Het
Cfap54	T	C	10: 92,801,219	N3103D	probably benign	Het
Chd9	G	A	8: 91,011,435	R1565Q	unknown	Het
Cir1	G	A	2: 73,303,808	T139I	probably damaging	Het
Cmah	T	C	13: 24,435,690		probably null	Het
Cnpy1	T	C	5: 28,245,802	D2G	probably damaging	Het
Dennd4a	A	T	9: 64,894,511	T979S	probably benign	Het
Dnah11	T	A	12: 117,878,576	K4423*	probably null	Het
Dnajb4	A	G	3: 152,186,683	I171T	possibly damaging	Het
Dpm1	A	T	2: 168,230,387		probably null	Het
Dtwd1	A	G	2: 126,154,675	T27A	probably benign	Het
Ep400	C	T	5: 110,742,006	D464N	unknown	Het
Epb42	A	T	2: 121,024,610	I498N	probably benign	Het
Fhod1	A	G	8: 105,337,416	V219A	unknown	Het
Gabrb2	A	T	11: 42,626,609	E419D	probably benign	Het
Galnt18	A	T	7: 111,471,961	N615K	possibly damaging	Het
Gm13084	T	C	4: 143,810,316	T482A	probably benign	Het
Gm29106	T	A	1: 118,199,524	H315Q	possibly damaging	Het
Gprin2	G	T	14: 34,195,658	Q52K	probably benign	Het
Grm4	A	T	17: 27,438,791	Y414N	probably damaging	Het
Gulo	C	A	14: 65,988,181		probably null	Het
H2-M1	A	C	17: 36,670,105	V313G	possibly damaging	Het
Hectd3	T	C	4: 116,995,754	W118R	probably damaging	Het
Hs6st3	G	A	14: 119,869,080	C300Y	probably damaging	Het
Il1rl2	T	A	1: 40,365,359	S547T	possibly damaging	Het
Kif20b	T	A	19: 34,950,749	L1137*	probably null	Het
Klhl7	A	G	5: 24,126,820		probably null	Het
Krt13	T	A	11: 100,121,161	D112V	possibly damaging	Het
Ltbr	A	G	6: 125,313,101	V71A	probably benign	Het
Ly6g	T	C	15: 75,158,609	V92A	probably benign	Het
Map2k3	G	A	11: 60,932,103		probably benign	Het
Mast2	A	C	4: 116,311,730	D842E	probably benign	Het
Mpo	T	G	11: 87,803,523	M693R	probably benign	Het
Myo15	C	A	11: 60,487,408	S212*	probably null	Het
Nadk2	C	T	15: 9,106,736	R37*	probably null	Het
Ncapd3	G	A	9: 27,063,359	R709H	probably benign	Het
Nck2	T	A	1: 43,533,732	Y55*	probably null	Het
Neurl4	A	G	11: 69,907,475	D777G	probably damaging	Het
Npr2	G	A	4: 43,633,527	V224M	possibly damaging	Het
Nptx2	T	A	5: 144,548,140	S148T	probably benign	Het
Nr1d1	T	C	11: 98,770,334	T369A	probably benign	Het
Nub1	T	G	5: 24,703,485	F411V	probably damaging	Het
Nup188	T	A	2: 30,304,288	Y158N	probably damaging	Het
Olfr1031	A	G	2: 85,992,747	Y310C	probably benign	Het
Olfr513	A	G	7: 108,755,432	N192S	probably benign	Het
Olfr716	A	T	7: 107,147,453	I46F	probably benign	Het
Olfr804	A	T	10: 129,705,339	I154F	probably damaging	Het
Olfr897-ps1	T	A	9: 38,309,632	I279K	unknown	Het
Orc2	C	T	1: 58,497,451	G85S	probably damaging	Het
Pak1ip1	T	A	13: 41,009,267	V182D	probably damaging	Het
Parvg	T	G	15: 84,326,223	C30W	probably benign	Het
Pcdha1	T	A	18: 36,932,660	D792E	probably benign	Het
Ppp1r13b	G	T	12: 111,833,808	Q635K	probably benign	Het
Psg16	A	G	7: 17,098,161	I341V	probably benign	Het
Psme4	C	T	11: 30,876,868	Q1796*	probably null	Het
Ptn	T	G	6: 36,715,764		probably null	Het
Rapsn	C	T	2: 91,045,478	P400L	probably damaging	Het
Rasal1	G	A	5: 120,662,293	G207D	probably damaging	Het
Rdx	A	G	9: 52,063,578	I5V	probably benign	Het
Rpf1	A	G	3: 146,517,778	I105T	probably damaging	Het
Rps15a	A	T	7: 118,109,997	F79I	possibly damaging	Het
Rwdd2b	G	A	16: 87,436,753	P153L	probably benign	Het
Scaf11	G	A	15: 96,420,417	S422L	probably damaging	Het
Serpinb3b	T	A	1: 107,154,673	E287V	possibly damaging	Het
Sgta	T	C	10: 81,051,284	D49G	possibly damaging	Het
Sin3a	T	A	9: 57,118,074	M1068K	probably benign	Het
Slc12a9	G	A	5: 137,321,409	R615W	probably damaging	Het
Slc26a3	T	A	12: 31,449,146	S151T	probably benign	Het
Slc4a8	C	A	15: 100,783,840	H111N	probably damaging	Het
Syngr1	G	A	15: 80,091,458	R22K	probably benign	Het
Tars2	A	T	3: 95,754,765	V25E	probably benign	Het
Tbx15	A	G	3: 99,352,331	Y506C	probably damaging	Het
Tgm4	A	T	9: 123,046,569	K162N	possibly damaging	Het
Tmem253	A	G	14: 52,017,982	E83G	probably damaging	Het
Trp73	G	A	4: 154,081,402	T118I	probably damaging	Het
Trpm7	A	G	2: 126,822,658	S934P	possibly damaging	Het
Ttc23l	G	A	15: 10,523,643	S330L	probably benign	Het
Tub	A	C	7: 109,025,638	D199A	probably benign	Het
Uri1	A	C	7: 37,996,685		probably null	Het
Usp16	C	T	16: 87,479,232	A486V	probably benign	Het
Vmn1r12	A	G	6: 57,159,541	I208V	probably benign	Het
Vmn2r116	A	T	17: 23,401,823	M844L	probably benign	Het
Vmn2r13	C	T	5: 109,191,907		probably null	Het
Xpnpep1	T	C	19: 53,013,461	D118G	probably damaging	Het
Zfp111	G	A	7: 24,198,642	P516S	possibly damaging	Het

Other mutations in Kank1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Kank1	APN	19	25411758	missense	probably benign
IGL00435:Kank1	APN	19	25430236	missense	probably benign	0.41
IGL01105:Kank1	APN	19	25424316	missense	possibly damaging	0.80
IGL01974:Kank1	APN	19	25410232	missense	possibly damaging	0.87
IGL02031:Kank1	APN	19	25410702	missense	probably benign	0.01
IGL02125:Kank1	APN	19	25410703	missense	possibly damaging	0.90
IGL02152:Kank1	APN	19	25428172	missense	possibly damaging	0.51
IGL02211:Kank1	APN	19	25430338	missense	probably damaging	1.00
IGL02440:Kank1	APN	19	25432908	missense	probably damaging	1.00
IGL02448:Kank1	APN	19	25411375	missense	probably damaging	1.00
IGL02671:Kank1	APN	19	25428095	missense	probably damaging	1.00
IGL03102:Kank1	APN	19	25425918	missense	probably damaging	1.00
IGL03259:Kank1	APN	19	25430341	missense	probably damaging	1.00
IGL02802:Kank1	UTSW	19	25411599	missense	probably damaging	1.00
R0107:Kank1	UTSW	19	25430366	unclassified	probably benign
R0190:Kank1	UTSW	19	25409283	missense	probably benign	0.00
R0330:Kank1	UTSW	19	25424313	missense	probably benign	0.00
R0368:Kank1	UTSW	19	25410603	nonsense	probably null
R0399:Kank1	UTSW	19	25411242	missense	probably benign	0.00
R0426:Kank1	UTSW	19	25411473	missense	probably damaging	1.00
R0483:Kank1	UTSW	19	25425993	unclassified	probably benign
R1394:Kank1	UTSW	19	25428164	missense	probably damaging	1.00
R1495:Kank1	UTSW	19	25410349	missense	probably damaging	0.98
R1681:Kank1	UTSW	19	25410304	missense	possibly damaging	0.89
R1698:Kank1	UTSW	19	25411317	missense	probably benign	0.11
R1830:Kank1	UTSW	19	25411032	missense	probably benign	0.00
R1866:Kank1	UTSW	19	25411449	missense	probably benign	0.04
R2138:Kank1	UTSW	19	25411753	missense	probably benign	0.00
R2139:Kank1	UTSW	19	25411753	missense	probably benign	0.00
R2420:Kank1	UTSW	19	25410457	missense	probably damaging	1.00
R3153:Kank1	UTSW	19	25410688	missense	possibly damaging	0.89
R4164:Kank1	UTSW	19	25411072	missense	probably benign	0.10
R4670:Kank1	UTSW	19	25410580	missense	probably benign	0.00
R4685:Kank1	UTSW	19	25410034	missense	possibly damaging	0.66
R4843:Kank1	UTSW	19	25431007	missense	probably damaging	1.00
R4981:Kank1	UTSW	19	25411395	missense	probably benign	0.19
R5189:Kank1	UTSW	19	25424181	missense	probably damaging	1.00
R5280:Kank1	UTSW	19	25411305	missense	probably benign	0.01
R5330:Kank1	UTSW	19	25411329	missense	probably damaging	1.00
R5331:Kank1	UTSW	19	25411329	missense	probably damaging	1.00
R5435:Kank1	UTSW	19	25411143	missense	probably benign	0.04
R5500:Kank1	UTSW	19	25424332	missense	possibly damaging	0.46
R5894:Kank1	UTSW	19	25424200	missense	probably damaging	1.00
R6087:Kank1	UTSW	19	25409724	missense	probably benign	0.41
R6357:Kank1	UTSW	19	25411353	missense	probably benign	0.36
R6490:Kank1	UTSW	19	25410085	missense	probably damaging	1.00
R6504:Kank1	UTSW	19	25428154	missense	probably damaging	1.00
R6942:Kank1	UTSW	19	25424173	missense	possibly damaging	0.88
R7037:Kank1	UTSW	19	25430341	missense	probably damaging	1.00
R7405:Kank1	UTSW	19	25410319	nonsense	probably null
R7486:Kank1	UTSW	19	25410829	missense	probably damaging	0.99
R7602:Kank1	UTSW	19	25422161	missense	probably benign	0.01
R7701:Kank1	UTSW	19	25411765	critical splice donor site	probably null
R7765:Kank1	UTSW	19	25411205	frame shift	probably null
R7766:Kank1	UTSW	19	25411205	frame shift	probably null
R7768:Kank1	UTSW	19	25411205	frame shift	probably null
R7919:Kank1	UTSW	19	25431075	missense	probably damaging	1.00
R7974:Kank1	UTSW	19	25424220	missense	probably damaging	1.00
R7978:Kank1	UTSW	19	25411205	frame shift	probably null
R8017:Kank1	UTSW	19	25411204	frame shift	probably null
R8017:Kank1	UTSW	19	25411205	frame shift	probably null
R8020:Kank1	UTSW	19	25411205	frame shift	probably null
R8150:Kank1	UTSW	19	25410799	missense	possibly damaging	0.88
R8322:Kank1	UTSW	19	25378478	start gained	probably benign
R8374:Kank1	UTSW	19	25411641	missense	probably damaging	0.97
R8705:Kank1	UTSW	19	25411543	missense	probably damaging	1.00
R8855:Kank1	UTSW	19	25411338	missense	possibly damaging	0.87
R8866:Kank1	UTSW	19	25411338	missense	possibly damaging	0.87
R8891:Kank1	UTSW	19	25410075	missense	probably benign	0.32
R8894:Kank1	UTSW	19	25431014	missense	probably damaging	1.00
R8917:Kank1	UTSW	19	25409564	missense	probably damaging	0.99
R9217:Kank1	UTSW	19	25409580	missense	possibly damaging	0.92
R9301:Kank1	UTSW	19	25411434	missense	probably benign	0.00
R9431:Kank1	UTSW	19	25410502	missense	probably damaging	1.00
R9603:Kank1	UTSW	19	25430925	missense	possibly damaging	0.95
R9680:Kank1	UTSW	19	25410774	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGACTTCCACTGAGTCTCTGTC -3'
(R):5'- CATTGCCTTGGTAGCCATTCTG -3'

Sequencing Primer
(F):5'- TGTCATCCTCCAACAGTGATGAC -3'
(R):5'- CTGAAGCTGGTGTATTGCAGAAC -3'

Posted On

2022-11-14