Incidental Mutation 'R9746:Xpnpep1'
ID 732175
Institutional Source Beutler Lab
Gene Symbol Xpnpep1
Ensembl Gene ENSMUSG00000025027
Gene Name X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Synonyms D230045I08Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9746 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 52943417-53040214 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 53013461 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 118 (D118G)
Ref Sequence ENSEMBL: ENSMUSP00000138250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182097] [ENSMUST00000182500] [ENSMUST00000183108] [ENSMUST00000183274]
AlphaFold Q6P1B1
Predicted Effect probably damaging
Transcript: ENSMUST00000182097
AA Change: D75G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138473
Gene: ENSMUSG00000025027
AA Change: D75G

DomainStartEndE-ValueType
Pfam:Creatinase_N 9 119 5.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182500
Predicted Effect probably damaging
Transcript: ENSMUST00000183108
AA Change: D118G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138250
Gene: ENSMUSG00000025027
AA Change: D118G

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 5.5e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183274
AA Change: D118G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138233
Gene: ENSMUSG00000025027
AA Change: D118G

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 1.9e-48 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cytosolic form of a metalloaminopeptidase that catalyzes the cleavage of the N-terminal amino acid adjacent to a proline residue. The gene product may play a role in degradation and maturation of tachykinins, neuropeptides, and peptide hormones. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit pre and postnatal lethality, reduced male survival, growth retardation with decreased body weight, size and length, microcephaly and peptiduria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 T A 1: 173,332,031 H307L probably benign Het
Acnat1 A T 4: 49,450,652 L153H probably damaging Het
Actn4 A T 7: 28,919,006 D76E probably benign Het
Afdn A C 17: 13,846,520 M640L probably benign Het
Angpt1 A T 15: 42,676,441 F7L probably benign Het
Ap3b2 A G 7: 81,476,344 F373S probably damaging Het
Armc2 T A 10: 41,924,461 Y650F probably damaging Het
Atg2b G T 12: 105,663,938 T398K possibly damaging Het
Baz1a CCATT CCATTCATT 12: 54,975,110 probably null Het
Capn8 G A 1: 182,611,105 probably null Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cfap54 T C 10: 92,801,219 N3103D probably benign Het
Chd9 G A 8: 91,011,435 R1565Q unknown Het
Cir1 G A 2: 73,303,808 T139I probably damaging Het
Cmah T C 13: 24,435,690 probably null Het
Cnpy1 T C 5: 28,245,802 D2G probably damaging Het
Dennd4a A T 9: 64,894,511 T979S probably benign Het
Dnah11 T A 12: 117,878,576 K4423* probably null Het
Dnajb4 A G 3: 152,186,683 I171T possibly damaging Het
Dpm1 A T 2: 168,230,387 probably null Het
Dtwd1 A G 2: 126,154,675 T27A probably benign Het
Ep400 C T 5: 110,742,006 D464N unknown Het
Epb42 A T 2: 121,024,610 I498N probably benign Het
Fhod1 A G 8: 105,337,416 V219A unknown Het
Gabrb2 A T 11: 42,626,609 E419D probably benign Het
Galnt18 A T 7: 111,471,961 N615K possibly damaging Het
Gm13084 T C 4: 143,810,316 T482A probably benign Het
Gm29106 T A 1: 118,199,524 H315Q possibly damaging Het
Gprin2 G T 14: 34,195,658 Q52K probably benign Het
Grm4 A T 17: 27,438,791 Y414N probably damaging Het
Gulo C A 14: 65,988,181 probably null Het
H2-M1 A C 17: 36,670,105 V313G possibly damaging Het
Hectd3 T C 4: 116,995,754 W118R probably damaging Het
Hs6st3 G A 14: 119,869,080 C300Y probably damaging Het
Il1rl2 T A 1: 40,365,359 S547T possibly damaging Het
Kank1 G T 19: 25,409,508 V182F probably damaging Het
Kif20b T A 19: 34,950,749 L1137* probably null Het
Klhl7 A G 5: 24,126,820 probably null Het
Krt13 T A 11: 100,121,161 D112V possibly damaging Het
Ltbr A G 6: 125,313,101 V71A probably benign Het
Ly6g T C 15: 75,158,609 V92A probably benign Het
Map2k3 G A 11: 60,932,103 probably benign Het
Mast2 A C 4: 116,311,730 D842E probably benign Het
Mpo T G 11: 87,803,523 M693R probably benign Het
Myo15 C A 11: 60,487,408 S212* probably null Het
Nadk2 C T 15: 9,106,736 R37* probably null Het
Ncapd3 G A 9: 27,063,359 R709H probably benign Het
Nck2 T A 1: 43,533,732 Y55* probably null Het
Neurl4 A G 11: 69,907,475 D777G probably damaging Het
Npr2 G A 4: 43,633,527 V224M possibly damaging Het
Nptx2 T A 5: 144,548,140 S148T probably benign Het
Nr1d1 T C 11: 98,770,334 T369A probably benign Het
Nub1 T G 5: 24,703,485 F411V probably damaging Het
Nup188 T A 2: 30,304,288 Y158N probably damaging Het
Olfr1031 A G 2: 85,992,747 Y310C probably benign Het
Olfr513 A G 7: 108,755,432 N192S probably benign Het
Olfr716 A T 7: 107,147,453 I46F probably benign Het
Olfr804 A T 10: 129,705,339 I154F probably damaging Het
Olfr897-ps1 T A 9: 38,309,632 I279K unknown Het
Orc2 C T 1: 58,497,451 G85S probably damaging Het
Pak1ip1 T A 13: 41,009,267 V182D probably damaging Het
Parvg T G 15: 84,326,223 C30W probably benign Het
Pcdha1 T A 18: 36,932,660 D792E probably benign Het
Ppp1r13b G T 12: 111,833,808 Q635K probably benign Het
Psg16 A G 7: 17,098,161 I341V probably benign Het
Psme4 C T 11: 30,876,868 Q1796* probably null Het
Ptn T G 6: 36,715,764 probably null Het
Rapsn C T 2: 91,045,478 P400L probably damaging Het
Rasal1 G A 5: 120,662,293 G207D probably damaging Het
Rdx A G 9: 52,063,578 I5V probably benign Het
Rpf1 A G 3: 146,517,778 I105T probably damaging Het
Rps15a A T 7: 118,109,997 F79I possibly damaging Het
Rwdd2b G A 16: 87,436,753 P153L probably benign Het
Scaf11 G A 15: 96,420,417 S422L probably damaging Het
Serpinb3b T A 1: 107,154,673 E287V possibly damaging Het
Sgta T C 10: 81,051,284 D49G possibly damaging Het
Sin3a T A 9: 57,118,074 M1068K probably benign Het
Slc12a9 G A 5: 137,321,409 R615W probably damaging Het
Slc26a3 T A 12: 31,449,146 S151T probably benign Het
Slc4a8 C A 15: 100,783,840 H111N probably damaging Het
Syngr1 G A 15: 80,091,458 R22K probably benign Het
Tars2 A T 3: 95,754,765 V25E probably benign Het
Tbx15 A G 3: 99,352,331 Y506C probably damaging Het
Tgm4 A T 9: 123,046,569 K162N possibly damaging Het
Tmem253 A G 14: 52,017,982 E83G probably damaging Het
Trp73 G A 4: 154,081,402 T118I probably damaging Het
Trpm7 A G 2: 126,822,658 S934P possibly damaging Het
Ttc23l G A 15: 10,523,643 S330L probably benign Het
Tub A C 7: 109,025,638 D199A probably benign Het
Uri1 A C 7: 37,996,685 probably null Het
Usp16 C T 16: 87,479,232 A486V probably benign Het
Vmn1r12 A G 6: 57,159,541 I208V probably benign Het
Vmn2r116 A T 17: 23,401,823 M844L probably benign Het
Vmn2r13 C T 5: 109,191,907 probably null Het
Zfp111 G A 7: 24,198,642 P516S possibly damaging Het
Other mutations in Xpnpep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Xpnpep1 APN 19 53010148 missense probably benign 0.06
IGL01665:Xpnpep1 APN 19 52997032 missense probably benign 0.00
IGL01833:Xpnpep1 APN 19 53000393 missense probably damaging 1.00
IGL02011:Xpnpep1 APN 19 53002465 critical splice donor site probably benign 0.00
IGL03229:Xpnpep1 APN 19 53025380 missense probably benign
IGL03334:Xpnpep1 APN 19 53010146 missense probably damaging 1.00
R0226:Xpnpep1 UTSW 19 53010152 missense probably benign 0.03
R0613:Xpnpep1 UTSW 19 53006353 missense probably damaging 0.97
R0648:Xpnpep1 UTSW 19 52997863 splice site probably benign
R1543:Xpnpep1 UTSW 19 52991676 missense probably benign 0.24
R1553:Xpnpep1 UTSW 19 53006338 missense probably benign 0.00
R1801:Xpnpep1 UTSW 19 53010133 missense probably damaging 1.00
R1853:Xpnpep1 UTSW 19 53006210 missense probably benign 0.01
R2234:Xpnpep1 UTSW 19 53013461 missense probably damaging 1.00
R3797:Xpnpep1 UTSW 19 53006342 missense probably benign 0.28
R3820:Xpnpep1 UTSW 19 53003819 splice site probably benign
R3822:Xpnpep1 UTSW 19 53003819 splice site probably benign
R3925:Xpnpep1 UTSW 19 52991697 missense probably damaging 1.00
R4831:Xpnpep1 UTSW 19 53014622 missense probably benign 0.09
R5033:Xpnpep1 UTSW 19 53006175 missense probably benign
R5184:Xpnpep1 UTSW 19 53013414 missense probably benign 0.24
R5468:Xpnpep1 UTSW 19 52995519 missense probably benign 0.01
R5573:Xpnpep1 UTSW 19 53004822 missense probably damaging 1.00
R5876:Xpnpep1 UTSW 19 52997008 missense probably damaging 1.00
R5929:Xpnpep1 UTSW 19 53013489 missense probably damaging 1.00
R6454:Xpnpep1 UTSW 19 52997879 missense possibly damaging 0.91
R6519:Xpnpep1 UTSW 19 53011844 missense possibly damaging 0.90
R7095:Xpnpep1 UTSW 19 53011765 critical splice donor site probably null
R7112:Xpnpep1 UTSW 19 53010107 missense probably benign
R7412:Xpnpep1 UTSW 19 53006291 missense probably benign
R8329:Xpnpep1 UTSW 19 53002472 critical splice donor site probably null
R8431:Xpnpep1 UTSW 19 52995506 missense probably benign 0.04
R9194:Xpnpep1 UTSW 19 53011858 missense possibly damaging 0.68
R9342:Xpnpep1 UTSW 19 53004817 missense probably benign 0.02
R9388:Xpnpep1 UTSW 19 53004802 missense probably damaging 1.00
R9546:Xpnpep1 UTSW 19 53002528 missense probably damaging 1.00
RF017:Xpnpep1 UTSW 19 53032060 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- AGCACTAAGATCCTGGGTCC -3'
(R):5'- CCTGGTCATCTAGGCTTCAG -3'

Sequencing Primer
(F):5'- TGGGTCCCCAAAGCATTC -3'
(R):5'- CTTCAGGACTGCTCTGAGAGAGTC -3'
Posted On 2022-11-14