Incidental Mutation 'R9747:Ccdc150'
ID 732179
Institutional Source Beutler Lab
Gene Symbol Ccdc150
Ensembl Gene ENSMUSG00000025983
Gene Name coiled-coil domain containing 150
Synonyms 4930511H11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R9747 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 54250683-54368727 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 54259948 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 28 (R28*)
Ref Sequence ENSEMBL: ENSMUSP00000027128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027128] [ENSMUST00000160472]
AlphaFold Q8CDI7
Predicted Effect probably null
Transcript: ENSMUST00000027128
AA Change: R28*
SMART Domains Protein: ENSMUSP00000027128
Gene: ENSMUSG00000025983
AA Change: R28*

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 676 N/A INTRINSIC
coiled coil region 727 952 N/A INTRINSIC
coiled coil region 985 1048 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160472
AA Change: R28*
SMART Domains Protein: ENSMUSP00000125195
Gene: ENSMUSG00000025983
AA Change: R28*

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 551 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,850,847 S701P probably damaging Het
9930021J03Rik C A 19: 29,754,511 C367F possibly damaging Het
Acsl1 A G 8: 46,508,360 K114R probably benign Het
Adam11 A G 11: 102,772,669 N275D probably damaging Het
Adamts19 G A 18: 58,890,415 R294H possibly damaging Het
Adamts20 C T 15: 94,283,062 C1666Y probably damaging Het
Ahnak A T 19: 9,010,177 I2942L possibly damaging Het
Ank1 A G 8: 23,086,977 H195R probably damaging Het
Ank2 T C 3: 126,959,018 T350A probably damaging Het
Asb3 T A 11: 31,058,946 N243K possibly damaging Het
Atp10b C T 11: 43,197,512 T315I probably benign Het
Avl9 C T 6: 56,753,840 S583F probably damaging Het
Bclaf1 A G 10: 20,332,146 K700E possibly damaging Het
Cacna1i G A 15: 80,362,117 E571K probably benign Het
Casp1 T A 9: 5,299,322 V17E probably damaging Het
Ccdc115 A T 1: 34,438,920 D76E probably benign Het
Cd36 T G 5: 17,814,734 E123A probably benign Het
Cd5l A C 3: 87,367,797 Q214H probably benign Het
Cfap46 T A 7: 139,611,991 H2370L unknown Het
Cftr C A 6: 18,285,637 T1148K possibly damaging Het
Col15a1 T A 4: 47,312,208 L1341Q probably damaging Het
Col6a6 T C 9: 105,784,040 E290G probably benign Het
D6Wsu163e A G 6: 126,962,014 E404G probably benign Het
Dchs1 A T 7: 105,763,475 D1239E probably damaging Het
Dennd4b C T 3: 90,270,521 T430I possibly damaging Het
Dmgdh C T 13: 93,688,646 P159L probably damaging Het
Dmrt3 G A 19: 25,622,639 D283N probably damaging Het
Dnttip1 A G 2: 164,765,180 D247G probably damaging Het
Efhc1 A T 1: 20,978,704 D447V probably damaging Het
Ehhadh T C 16: 21,766,388 K248E probably benign Het
Eif4enif1 T C 11: 3,213,267 L34P probably damaging Het
Fer T C 17: 63,907,381 M103T probably benign Het
Gabrg1 T C 5: 70,780,686 M197V probably damaging Het
Galnt5 C A 2: 57,999,465 T359K probably benign Het
Gm8108 G T 14: 4,110,527 probably benign Het
Gna12 T C 5: 140,760,847 N281S probably damaging Het
Golgb1 C T 16: 36,893,407 T250I probably damaging Het
Gpd1 A G 15: 99,720,123 K130E probably benign Het
Gys2 A T 6: 142,449,455 M428K possibly damaging Het
Hey2 A C 10: 30,833,828 S310A probably benign Het
Ifi47 T C 11: 49,096,540 V378A possibly damaging Het
Ighv8-12 A G 12: 115,648,020 S95P probably damaging Het
Igkv1-131 G T 6: 67,766,231 T56K probably damaging Het
Igsf23 T C 7: 19,941,914 N127S probably benign Het
Iqgap2 T A 13: 95,684,997 N546I probably damaging Het
Irf9 A G 14: 55,606,588 H270R probably benign Het
Itga6 C T 2: 71,826,527 S375L probably damaging Het
Jak1 T C 4: 101,158,890 E857G probably benign Het
Kbtbd8 A G 6: 95,121,857 T116A possibly damaging Het
Kif5a T C 10: 127,238,753 I570V probably benign Het
Klhdc10 T C 6: 30,439,860 M154T possibly damaging Het
Krtap6-2 A G 16: 89,419,888 Y64H unknown Het
Lce1l C T 3: 92,850,521 C10Y unknown Het
Lrrc72 A G 12: 36,214,372 Y29H probably damaging Het
Ltbp2 A T 12: 84,868,741 N181K probably damaging Het
Ly75 A G 2: 60,306,328 probably null Het
Mpped1 A G 15: 83,800,104 Y109C probably damaging Het
Mrgpra2a C T 7: 47,426,710 V267I probably benign Het
Muc4 T A 16: 32,754,698 V1524E probably benign Het
Nabp2 T A 10: 128,401,741 R208* probably null Het
Ndst3 A G 3: 123,546,812 F786L possibly damaging Het
Nos2 C T 11: 78,931,646 P123S probably damaging Het
Nrcam T A 12: 44,598,409 V1198E probably damaging Het
Oacyl A G 18: 65,747,891 Q592R possibly damaging Het
Olfr1111 T A 2: 87,150,554 T36S probably benign Het
Olfr1331 C T 4: 118,869,020 P80S probably damaging Het
Pcdhgc4 A G 18: 37,817,973 Y814C probably benign Het
Pcm1 A C 8: 41,304,098 H1349P probably benign Het
Pcsk6 T A 7: 65,983,722 D567E probably damaging Het
Pdgfd T C 9: 6,337,310 V214A probably benign Het
Plekhg3 A T 12: 76,564,593 N270I probably damaging Het
Rasgrf1 T A 9: 89,994,994 V804E probably benign Het
Rbl1 G T 2: 157,192,046 L371I probably damaging Het
Rcl1 T A 19: 29,128,082 I223N probably damaging Het
Saa4 C T 7: 46,731,653 G15E probably damaging Het
Selenbp1 T C 3: 94,937,337 S102P probably damaging Het
Setx G T 2: 29,174,365 E232* probably null Het
Sik2 A G 9: 50,898,758 F502L possibly damaging Het
Slamf9 A T 1: 172,478,215 I272F unknown Het
Slc33a1 A T 3: 63,954,003 D259E probably benign Het
Slc41a3 A G 6: 90,644,156 I393V probably benign Het
Slk A G 19: 47,619,907 D433G possibly damaging Het
Spata13 C T 14: 60,691,791 P266L probably benign Het
Speer4c T A 5: 15,711,654 Q105L probably benign Het
Srgap1 A G 10: 121,792,674 S818P probably benign Het
Srgap1 T A 10: 121,925,866 I126F probably damaging Het
Tbpl2 A T 2: 24,091,092 C232* probably null Het
Tctn3 T G 19: 40,611,299 N153T possibly damaging Het
Tdrd1 T A 19: 56,858,669 V914E probably benign Het
Tmem200b A G 4: 131,922,048 H93R possibly damaging Het
Tmem33 T G 5: 67,268,579 N155K possibly damaging Het
Tmprss15 T C 16: 79,087,512 D94G probably benign Het
Tnpo2 A G 8: 85,055,359 D869G probably benign Het
Traf6 C T 2: 101,696,684 R260* probably null Het
Ttn C T 2: 76,763,949 V20552I possibly damaging Het
Vmn2r102 T A 17: 19,677,867 D381E probably benign Het
Vmn2r92 T C 17: 18,184,939 F782L possibly damaging Het
Zfc3h1 G A 10: 115,408,916 D765N possibly damaging Het
Zfp472 T A 17: 32,977,297 H115Q possibly damaging Het
Zmynd11 T A 13: 9,689,208 N514I probably benign Het
Other mutations in Ccdc150
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00712:Ccdc150 APN 1 54272550 splice site probably benign
IGL00819:Ccdc150 APN 1 54263573 missense probably damaging 1.00
IGL01973:Ccdc150 APN 1 54300488 splice site probably null
IGL02352:Ccdc150 APN 1 54272521 missense probably benign 0.25
IGL02359:Ccdc150 APN 1 54272521 missense probably benign 0.25
IGL02620:Ccdc150 APN 1 54263545 nonsense probably null
IGL02673:Ccdc150 APN 1 54328990 missense probably benign 0.09
IGL03148:Ccdc150 APN 1 54278715 missense possibly damaging 0.68
IGL03185:Ccdc150 APN 1 54300323 missense probably damaging 1.00
IGL03014:Ccdc150 UTSW 1 54290702 missense probably damaging 0.99
R0066:Ccdc150 UTSW 1 54356691 missense probably benign
R0066:Ccdc150 UTSW 1 54356691 missense probably benign
R0217:Ccdc150 UTSW 1 54300430 missense possibly damaging 0.87
R0582:Ccdc150 UTSW 1 54329511 missense probably benign
R0687:Ccdc150 UTSW 1 54285631 splice site probably null
R0790:Ccdc150 UTSW 1 54277776 splice site probably benign
R1146:Ccdc150 UTSW 1 54364971 splice site probably benign
R1288:Ccdc150 UTSW 1 54364458 missense probably damaging 1.00
R1763:Ccdc150 UTSW 1 54354636 missense probably benign 0.42
R1855:Ccdc150 UTSW 1 54367910 intron probably benign
R1957:Ccdc150 UTSW 1 54263909 missense probably benign 0.00
R2180:Ccdc150 UTSW 1 54272547 critical splice donor site probably null
R2226:Ccdc150 UTSW 1 54364925 missense probably null 0.11
R3054:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3055:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3056:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3409:Ccdc150 UTSW 1 54356773 missense probably benign 0.02
R3411:Ccdc150 UTSW 1 54356773 missense probably benign 0.02
R3812:Ccdc150 UTSW 1 54368310 missense probably benign 0.00
R4031:Ccdc150 UTSW 1 54278811 missense probably benign 0.31
R4356:Ccdc150 UTSW 1 54353054 missense probably damaging 0.98
R4617:Ccdc150 UTSW 1 54355754 missense probably benign 0.00
R4757:Ccdc150 UTSW 1 54278715 missense possibly damaging 0.81
R4957:Ccdc150 UTSW 1 54364868 intron probably benign
R5028:Ccdc150 UTSW 1 54263477 missense probably benign 0.01
R5512:Ccdc150 UTSW 1 54354647 missense probably damaging 0.96
R5757:Ccdc150 UTSW 1 54263620 missense probably damaging 1.00
R5943:Ccdc150 UTSW 1 54300367 missense probably benign 0.01
R5948:Ccdc150 UTSW 1 54277714 missense possibly damaging 0.79
R6033:Ccdc150 UTSW 1 54285628 critical splice donor site probably null
R6033:Ccdc150 UTSW 1 54285628 critical splice donor site probably null
R6065:Ccdc150 UTSW 1 54263599 missense possibly damaging 0.90
R6390:Ccdc150 UTSW 1 54368017 missense probably benign 0.01
R6399:Ccdc150 UTSW 1 54263957 splice site probably null
R6988:Ccdc150 UTSW 1 54355709 nonsense probably null
R7248:Ccdc150 UTSW 1 54304898 missense probably benign 0.00
R7319:Ccdc150 UTSW 1 54263337 splice site probably null
R7322:Ccdc150 UTSW 1 54259966 missense probably benign 0.01
R7366:Ccdc150 UTSW 1 54300382 nonsense probably null
R7647:Ccdc150 UTSW 1 54356704 missense probably damaging 1.00
R7981:Ccdc150 UTSW 1 54368392 missense probably damaging 1.00
R8002:Ccdc150 UTSW 1 54272497 missense probably damaging 0.99
R8201:Ccdc150 UTSW 1 54329487 missense probably benign 0.10
R8688:Ccdc150 UTSW 1 54367973 missense probably damaging 1.00
R8719:Ccdc150 UTSW 1 54263509 missense probably benign 0.00
R8963:Ccdc150 UTSW 1 54272482 missense probably benign 0.14
R9178:Ccdc150 UTSW 1 54272485 missense probably damaging 0.99
R9200:Ccdc150 UTSW 1 54260038 missense probably damaging 1.00
R9332:Ccdc150 UTSW 1 54277751 missense probably damaging 0.99
R9367:Ccdc150 UTSW 1 54285601 missense probably damaging 1.00
R9416:Ccdc150 UTSW 1 54278831 missense probably damaging 0.97
R9430:Ccdc150 UTSW 1 54281771 missense probably damaging 1.00
R9576:Ccdc150 UTSW 1 54368385 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGCTCCCTCAGAAGTCTTAGG -3'
(R):5'- TTGTGTCAAAGCTCATATGGAAACC -3'

Sequencing Primer
(F):5'- CTGACCTGTGGAACAAATCTATCTGG -3'
(R):5'- CCAAAGGTATCTCTCTCATCTGC -3'
Posted On 2022-11-14