Incidental Mutation 'R9747:Ly75'
ID 732184
Institutional Source Beutler Lab
Gene Symbol Ly75
Ensembl Gene ENSMUSG00000026980
Gene Name lymphocyte antigen 75
Synonyms DEC-205, CD205
Accession Numbers

Genbank: NM_013825

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9747 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 60292103-60383303 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 60306328 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028362] [ENSMUST00000112533]
AlphaFold Q60767
Predicted Effect probably null
Transcript: ENSMUST00000028362
SMART Domains Protein: ENSMUSP00000028362
Gene: ENSMUSG00000026980

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112533
SMART Domains Protein: ENSMUSP00000108152
Gene: ENSMUSG00000026980

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display abnormalities in CD8-positive T cell morphology and cytotoxic T cell physiology. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,850,847 S701P probably damaging Het
9930021J03Rik C A 19: 29,754,511 C367F possibly damaging Het
Acsl1 A G 8: 46,508,360 K114R probably benign Het
Adam11 A G 11: 102,772,669 N275D probably damaging Het
Adamts19 G A 18: 58,890,415 R294H possibly damaging Het
Adamts20 C T 15: 94,283,062 C1666Y probably damaging Het
Ahnak A T 19: 9,010,177 I2942L possibly damaging Het
Ank1 A G 8: 23,086,977 H195R probably damaging Het
Ank2 T C 3: 126,959,018 T350A probably damaging Het
Asb3 T A 11: 31,058,946 N243K possibly damaging Het
Atp10b C T 11: 43,197,512 T315I probably benign Het
Avl9 C T 6: 56,753,840 S583F probably damaging Het
Bclaf1 A G 10: 20,332,146 K700E possibly damaging Het
Cacna1i G A 15: 80,362,117 E571K probably benign Het
Casp1 T A 9: 5,299,322 V17E probably damaging Het
Ccdc115 A T 1: 34,438,920 D76E probably benign Het
Ccdc150 A T 1: 54,259,948 R28* probably null Het
Cd36 T G 5: 17,814,734 E123A probably benign Het
Cd5l A C 3: 87,367,797 Q214H probably benign Het
Cfap46 T A 7: 139,611,991 H2370L unknown Het
Cftr C A 6: 18,285,637 T1148K possibly damaging Het
Col15a1 T A 4: 47,312,208 L1341Q probably damaging Het
Col6a6 T C 9: 105,784,040 E290G probably benign Het
D6Wsu163e A G 6: 126,962,014 E404G probably benign Het
Dchs1 A T 7: 105,763,475 D1239E probably damaging Het
Dennd4b C T 3: 90,270,521 T430I possibly damaging Het
Dmgdh C T 13: 93,688,646 P159L probably damaging Het
Dmrt3 G A 19: 25,622,639 D283N probably damaging Het
Dnttip1 A G 2: 164,765,180 D247G probably damaging Het
Efhc1 A T 1: 20,978,704 D447V probably damaging Het
Ehhadh T C 16: 21,766,388 K248E probably benign Het
Eif4enif1 T C 11: 3,213,267 L34P probably damaging Het
Fer T C 17: 63,907,381 M103T probably benign Het
Gabrg1 T C 5: 70,780,686 M197V probably damaging Het
Galnt5 C A 2: 57,999,465 T359K probably benign Het
Gm8108 G T 14: 4,110,527 probably benign Het
Gna12 T C 5: 140,760,847 N281S probably damaging Het
Golgb1 C T 16: 36,893,407 T250I probably damaging Het
Gpd1 A G 15: 99,720,123 K130E probably benign Het
Gys2 A T 6: 142,449,455 M428K possibly damaging Het
Hey2 A C 10: 30,833,828 S310A probably benign Het
Ifi47 T C 11: 49,096,540 V378A possibly damaging Het
Ighv8-12 A G 12: 115,648,020 S95P probably damaging Het
Igkv1-131 G T 6: 67,766,231 T56K probably damaging Het
Igsf23 T C 7: 19,941,914 N127S probably benign Het
Iqgap2 T A 13: 95,684,997 N546I probably damaging Het
Irf9 A G 14: 55,606,588 H270R probably benign Het
Itga6 C T 2: 71,826,527 S375L probably damaging Het
Jak1 T C 4: 101,158,890 E857G probably benign Het
Kbtbd8 A G 6: 95,121,857 T116A possibly damaging Het
Kif5a T C 10: 127,238,753 I570V probably benign Het
Klhdc10 T C 6: 30,439,860 M154T possibly damaging Het
Krtap6-2 A G 16: 89,419,888 Y64H unknown Het
Lce1l C T 3: 92,850,521 C10Y unknown Het
Lrrc72 A G 12: 36,214,372 Y29H probably damaging Het
Ltbp2 A T 12: 84,868,741 N181K probably damaging Het
Mpped1 A G 15: 83,800,104 Y109C probably damaging Het
Mrgpra2a C T 7: 47,426,710 V267I probably benign Het
Muc4 T A 16: 32,754,698 V1524E probably benign Het
Nabp2 T A 10: 128,401,741 R208* probably null Het
Ndst3 A G 3: 123,546,812 F786L possibly damaging Het
Nos2 C T 11: 78,931,646 P123S probably damaging Het
Nrcam T A 12: 44,598,409 V1198E probably damaging Het
Oacyl A G 18: 65,747,891 Q592R possibly damaging Het
Olfr1111 T A 2: 87,150,554 T36S probably benign Het
Olfr1331 C T 4: 118,869,020 P80S probably damaging Het
Pcdhgc4 A G 18: 37,817,973 Y814C probably benign Het
Pcm1 A C 8: 41,304,098 H1349P probably benign Het
Pcsk6 T A 7: 65,983,722 D567E probably damaging Het
Pdgfd T C 9: 6,337,310 V214A probably benign Het
Plekhg3 A T 12: 76,564,593 N270I probably damaging Het
Rasgrf1 T A 9: 89,994,994 V804E probably benign Het
Rbl1 G T 2: 157,192,046 L371I probably damaging Het
Rcl1 T A 19: 29,128,082 I223N probably damaging Het
Saa4 C T 7: 46,731,653 G15E probably damaging Het
Selenbp1 T C 3: 94,937,337 S102P probably damaging Het
Setx G T 2: 29,174,365 E232* probably null Het
Sik2 A G 9: 50,898,758 F502L possibly damaging Het
Slamf9 A T 1: 172,478,215 I272F unknown Het
Slc33a1 A T 3: 63,954,003 D259E probably benign Het
Slc41a3 A G 6: 90,644,156 I393V probably benign Het
Slk A G 19: 47,619,907 D433G possibly damaging Het
Spata13 C T 14: 60,691,791 P266L probably benign Het
Speer4c T A 5: 15,711,654 Q105L probably benign Het
Srgap1 A G 10: 121,792,674 S818P probably benign Het
Srgap1 T A 10: 121,925,866 I126F probably damaging Het
Tbpl2 A T 2: 24,091,092 C232* probably null Het
Tctn3 T G 19: 40,611,299 N153T possibly damaging Het
Tdrd1 T A 19: 56,858,669 V914E probably benign Het
Tmem200b A G 4: 131,922,048 H93R possibly damaging Het
Tmem33 T G 5: 67,268,579 N155K possibly damaging Het
Tmprss15 T C 16: 79,087,512 D94G probably benign Het
Tnpo2 A G 8: 85,055,359 D869G probably benign Het
Traf6 C T 2: 101,696,684 R260* probably null Het
Ttn C T 2: 76,763,949 V20552I possibly damaging Het
Vmn2r102 T A 17: 19,677,867 D381E probably benign Het
Vmn2r92 T C 17: 18,184,939 F782L possibly damaging Het
Zfc3h1 G A 10: 115,408,916 D765N possibly damaging Het
Zfp472 T A 17: 32,977,297 H115Q possibly damaging Het
Zmynd11 T A 13: 9,689,208 N514I probably benign Het
Other mutations in Ly75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Ly75 APN 2 60376077 missense probably damaging 1.00
IGL01072:Ly75 APN 2 60354496 missense probably damaging 1.00
IGL01409:Ly75 APN 2 60321692 splice site probably null
IGL01432:Ly75 APN 2 60376007 missense probably damaging 1.00
IGL01626:Ly75 APN 2 60301015 missense probably benign 0.13
IGL01690:Ly75 APN 2 60338311 missense probably damaging 1.00
IGL01862:Ly75 APN 2 60299172 missense probably damaging 1.00
IGL01982:Ly75 APN 2 60311764 missense probably damaging 1.00
IGL02075:Ly75 APN 2 60352356 missense probably damaging 0.99
IGL02338:Ly75 APN 2 60354452 missense probably benign 0.04
IGL02364:Ly75 APN 2 60358507 missense probably damaging 1.00
IGL02456:Ly75 APN 2 60293781 missense probably benign 0.09
IGL02474:Ly75 APN 2 60383182 missense probably null 1.00
IGL02608:Ly75 APN 2 60321900 missense probably benign 0.41
IGL02986:Ly75 APN 2 60308191 missense probably damaging 1.00
IGL03015:Ly75 APN 2 60376160 missense probably damaging 1.00
IGL03049:Ly75 APN 2 60352070 missense probably damaging 0.99
euphues UTSW 2 60299045 critical splice donor site probably null
four_score UTSW 2 60311771 missense possibly damaging 0.75
lyly UTSW 2 60327873 missense possibly damaging 0.49
Witty UTSW 2 60354500 missense probably damaging 1.00
D605:Ly75 UTSW 2 60352352 critical splice donor site probably null
R0046:Ly75 UTSW 2 60339457 intron probably benign
R0055:Ly75 UTSW 2 60321918 missense probably benign 0.01
R0055:Ly75 UTSW 2 60321918 missense probably benign 0.01
R0071:Ly75 UTSW 2 60321819 missense probably benign 0.01
R0071:Ly75 UTSW 2 60321819 missense probably benign 0.01
R0285:Ly75 UTSW 2 60318319 missense probably damaging 1.00
R0387:Ly75 UTSW 2 60306404 missense probably benign 0.20
R0492:Ly75 UTSW 2 60308276 missense probably damaging 1.00
R0688:Ly75 UTSW 2 60316221 missense probably benign 0.41
R1367:Ly75 UTSW 2 60293758 splice site probably null
R1463:Ly75 UTSW 2 60368757 critical splice donor site probably null
R1581:Ly75 UTSW 2 60327893 missense probably damaging 1.00
R1663:Ly75 UTSW 2 60314234 missense probably damaging 1.00
R1818:Ly75 UTSW 2 60311777 missense probably damaging 1.00
R1881:Ly75 UTSW 2 60349940 missense probably benign 0.00
R2244:Ly75 UTSW 2 60349913 missense probably benign 0.01
R2905:Ly75 UTSW 2 60334554 missense probably benign 0.00
R3967:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R3968:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R4039:Ly75 UTSW 2 60352995 missense probably damaging 1.00
R4406:Ly75 UTSW 2 60354550 missense probably damaging 1.00
R4526:Ly75 UTSW 2 60330773 missense probably benign 0.09
R4647:Ly75 UTSW 2 60308278 missense probably damaging 1.00
R4795:Ly75 UTSW 2 60349940 missense probably benign 0.00
R4796:Ly75 UTSW 2 60349940 missense probably benign 0.00
R4962:Ly75 UTSW 2 60352125 missense probably damaging 1.00
R4979:Ly75 UTSW 2 60375894 missense probably damaging 1.00
R5072:Ly75 UTSW 2 60375963 missense probably damaging 1.00
R5288:Ly75 UTSW 2 60303641 missense probably damaging 1.00
R5373:Ly75 UTSW 2 60311771 missense possibly damaging 0.75
R5374:Ly75 UTSW 2 60311771 missense possibly damaging 0.75
R5384:Ly75 UTSW 2 60334487 nonsense probably null
R5385:Ly75 UTSW 2 60303641 missense probably damaging 1.00
R5395:Ly75 UTSW 2 60365111 missense probably benign 0.41
R5531:Ly75 UTSW 2 60365145 missense probably damaging 0.98
R5662:Ly75 UTSW 2 60352381 missense probably damaging 1.00
R5667:Ly75 UTSW 2 60308311 missense probably damaging 1.00
R5668:Ly75 UTSW 2 60354500 missense probably damaging 1.00
R5671:Ly75 UTSW 2 60308311 missense probably damaging 1.00
R5677:Ly75 UTSW 2 60299082 missense probably benign 0.00
R5764:Ly75 UTSW 2 60318439 missense probably benign
R5896:Ly75 UTSW 2 60383146 missense probably benign
R6025:Ly75 UTSW 2 60375962 missense probably damaging 1.00
R6113:Ly75 UTSW 2 60368873 missense probably benign 0.04
R6448:Ly75 UTSW 2 60299045 critical splice donor site probably null
R6601:Ly75 UTSW 2 60318376 missense probably benign 0.11
R6745:Ly75 UTSW 2 60308179 missense probably damaging 1.00
R6955:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R6960:Ly75 UTSW 2 60306405 missense probably benign
R7100:Ly75 UTSW 2 60306434 missense probably benign
R7110:Ly75 UTSW 2 60376184 missense probably benign 0.31
R7203:Ly75 UTSW 2 60323852 nonsense probably null
R7291:Ly75 UTSW 2 60329993 missense probably damaging 0.98
R7308:Ly75 UTSW 2 60334515 missense probably benign 0.04
R7447:Ly75 UTSW 2 60334474 nonsense probably null
R7512:Ly75 UTSW 2 60334563 missense probably damaging 1.00
R7595:Ly75 UTSW 2 60293827 missense probably benign 0.01
R7976:Ly75 UTSW 2 60365088 missense probably damaging 1.00
R8005:Ly75 UTSW 2 60332934 missense probably damaging 1.00
R8171:Ly75 UTSW 2 60314228 missense possibly damaging 0.51
R8392:Ly75 UTSW 2 60349940 missense probably benign 0.00
R8705:Ly75 UTSW 2 60318385 missense probably damaging 0.98
R8714:Ly75 UTSW 2 60334485 missense probably damaging 1.00
R8798:Ly75 UTSW 2 60323926 missense probably benign 0.32
R8799:Ly75 UTSW 2 60348441 missense probably damaging 1.00
R8834:Ly75 UTSW 2 60331089 missense probably benign
R8990:Ly75 UTSW 2 60358559 missense probably benign 0.10
R9015:Ly75 UTSW 2 60316098 missense probably benign
R9547:Ly75 UTSW 2 60330725 critical splice donor site probably null
R9628:Ly75 UTSW 2 60327941 missense probably damaging 1.00
R9659:Ly75 UTSW 2 60338321 missense probably damaging 1.00
R9660:Ly75 UTSW 2 60323840 missense probably damaging 1.00
X0025:Ly75 UTSW 2 60354475 missense probably damaging 1.00
Z1177:Ly75 UTSW 2 60350004 nonsense probably null
Z1177:Ly75 UTSW 2 60352133 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- ACGCCACAGCTTCTAGGATTC -3'
(R):5'- CAGGGAAGCGAATCGAGTTTC -3'

Sequencing Primer
(F):5'- CAGGCAGATCTCTATGAGTTCCAG -3'
(R):5'- TCGAATGGTCCGATGGCAG -3'
Posted On 2022-11-14