Incidental Mutation 'R9747:Casp1'
ID 732225
Institutional Source Beutler Lab
Gene Symbol Casp1
Ensembl Gene ENSMUSG00000025888
Gene Name caspase 1
Synonyms Caspase-1, Il1bc, interleukin 1 beta-converting enzyme, ICE
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9747 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 5298517-5307281 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 5299322 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 17 (V17E)
Ref Sequence ENSEMBL: ENSMUSP00000027015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027015]
AlphaFold P29452
Predicted Effect probably damaging
Transcript: ENSMUST00000027015
AA Change: V17E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027015
Gene: ENSMUSG00000025888
AA Change: V17E

DomainStartEndE-ValueType
CARD 4 89 4.91e-19 SMART
CASc 151 400 1.82e-136 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce 2 subunits, large and small, that dimerize to form the active enzyme. This gene was identified by its ability to proteolytically cleave and activate the inactive precursor of interleukin-1, a cytokine involved in the processes such as inflammation, septic shock, and wound healing. This gene has been shown to induce cell apoptosis and may function in various developmental stages. Studies of a similar gene in mouse suggest a role in the pathogenesis of Huntington disease. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous targeted mutants fail to produce mature IL1A and IL1B and are resistant to LPS-induced endotoxin shock and to FAS antibody-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,668,711 (GRCm39) S701P probably damaging Het
Acsl1 A G 8: 46,961,397 (GRCm39) K114R probably benign Het
Adam11 A G 11: 102,663,495 (GRCm39) N275D probably damaging Het
Adamts19 G A 18: 59,023,487 (GRCm39) R294H possibly damaging Het
Adamts20 C T 15: 94,180,943 (GRCm39) C1666Y probably damaging Het
Ahnak A T 19: 8,987,541 (GRCm39) I2942L possibly damaging Het
Ank1 A G 8: 23,576,993 (GRCm39) H195R probably damaging Het
Ank2 T C 3: 126,752,667 (GRCm39) T350A probably damaging Het
Asb3 T A 11: 31,008,946 (GRCm39) N243K possibly damaging Het
Atp10b C T 11: 43,088,339 (GRCm39) T315I probably benign Het
Avl9 C T 6: 56,730,825 (GRCm39) S583F probably damaging Het
Bclaf1 A G 10: 20,207,892 (GRCm39) K700E possibly damaging Het
Brd10 C A 19: 29,731,911 (GRCm39) C367F possibly damaging Het
Cacna1i G A 15: 80,246,318 (GRCm39) E571K probably benign Het
Ccdc115 A T 1: 34,478,001 (GRCm39) D76E probably benign Het
Ccdc150 A T 1: 54,299,107 (GRCm39) R28* probably null Het
Cd36 T G 5: 18,019,732 (GRCm39) E123A probably benign Het
Cd5l A C 3: 87,275,104 (GRCm39) Q214H probably benign Het
Cfap46 T A 7: 139,191,907 (GRCm39) H2370L unknown Het
Cftr C A 6: 18,285,636 (GRCm39) T1148K possibly damaging Het
Col15a1 T A 4: 47,312,208 (GRCm39) L1341Q probably damaging Het
Col6a6 T C 9: 105,661,239 (GRCm39) E290G probably benign Het
D6Wsu163e A G 6: 126,938,977 (GRCm39) E404G probably benign Het
Dchs1 A T 7: 105,412,682 (GRCm39) D1239E probably damaging Het
Dennd4b C T 3: 90,177,828 (GRCm39) T430I possibly damaging Het
Dmgdh C T 13: 93,825,154 (GRCm39) P159L probably damaging Het
Dmrt3 G A 19: 25,600,003 (GRCm39) D283N probably damaging Het
Dnttip1 A G 2: 164,607,100 (GRCm39) D247G probably damaging Het
Efhc1 A T 1: 21,048,928 (GRCm39) D447V probably damaging Het
Ehhadh T C 16: 21,585,138 (GRCm39) K248E probably benign Het
Eif4enif1 T C 11: 3,163,267 (GRCm39) L34P probably damaging Het
Fer T C 17: 64,214,376 (GRCm39) M103T probably benign Het
Gabrg1 T C 5: 70,938,029 (GRCm39) M197V probably damaging Het
Galnt5 C A 2: 57,889,477 (GRCm39) T359K probably benign Het
Gm8108 G T 14: 4,110,527 (GRCm38) probably benign Het
Gna12 T C 5: 140,746,602 (GRCm39) N281S probably damaging Het
Golgb1 C T 16: 36,713,769 (GRCm39) T250I probably damaging Het
Gpd1 A G 15: 99,618,004 (GRCm39) K130E probably benign Het
Gys2 A T 6: 142,395,181 (GRCm39) M428K possibly damaging Het
Hey2 A C 10: 30,709,824 (GRCm39) S310A probably benign Het
Ifi47 T C 11: 48,987,367 (GRCm39) V378A possibly damaging Het
Ighv8-12 A G 12: 115,611,640 (GRCm39) S95P probably damaging Het
Igkv1-131 G T 6: 67,743,215 (GRCm39) T56K probably damaging Het
Igsf23 T C 7: 19,675,839 (GRCm39) N127S probably benign Het
Iqgap2 T A 13: 95,821,505 (GRCm39) N546I probably damaging Het
Irf9 A G 14: 55,844,045 (GRCm39) H270R probably benign Het
Itga6 C T 2: 71,656,871 (GRCm39) S375L probably damaging Het
Jak1 T C 4: 101,016,087 (GRCm39) E857G probably benign Het
Kbtbd8 A G 6: 95,098,838 (GRCm39) T116A possibly damaging Het
Kif5a T C 10: 127,074,622 (GRCm39) I570V probably benign Het
Klhdc10 T C 6: 30,439,859 (GRCm39) M154T possibly damaging Het
Krtap6-2 A G 16: 89,216,776 (GRCm39) Y64H unknown Het
Lce1l C T 3: 92,757,828 (GRCm39) C10Y unknown Het
Lrrc72 A G 12: 36,264,371 (GRCm39) Y29H probably damaging Het
Ltbp2 A T 12: 84,915,515 (GRCm39) N181K probably damaging Het
Ly75 A G 2: 60,136,672 (GRCm39) probably null Het
Mpped1 A G 15: 83,684,305 (GRCm39) Y109C probably damaging Het
Mrgpra2a C T 7: 47,076,458 (GRCm39) V267I probably benign Het
Muc4 T A 16: 32,754,698 (GRCm38) V1524E probably benign Het
Nabp2 T A 10: 128,237,610 (GRCm39) R208* probably null Het
Ndst3 A G 3: 123,340,461 (GRCm39) F786L possibly damaging Het
Nos2 C T 11: 78,822,472 (GRCm39) P123S probably damaging Het
Nrcam T A 12: 44,645,192 (GRCm39) V1198E probably damaging Het
Oacyl A G 18: 65,880,962 (GRCm39) Q592R possibly damaging Het
Or10ak9 C T 4: 118,726,217 (GRCm39) P80S probably damaging Het
Or5as1 T A 2: 86,980,898 (GRCm39) T36S probably benign Het
Pcdhgc4 A G 18: 37,951,026 (GRCm39) Y814C probably benign Het
Pcm1 A C 8: 41,757,135 (GRCm39) H1349P probably benign Het
Pcsk6 T A 7: 65,633,470 (GRCm39) D567E probably damaging Het
Pdgfd T C 9: 6,337,310 (GRCm39) V214A probably benign Het
Plekhg3 A T 12: 76,611,367 (GRCm39) N270I probably damaging Het
Rasgrf1 T A 9: 89,877,047 (GRCm39) V804E probably benign Het
Rbl1 G T 2: 157,033,966 (GRCm39) L371I probably damaging Het
Rcl1 T A 19: 29,105,482 (GRCm39) I223N probably damaging Het
Saa4 C T 7: 46,381,077 (GRCm39) G15E probably damaging Het
Selenbp1 T C 3: 94,844,648 (GRCm39) S102P probably damaging Het
Setx G T 2: 29,064,377 (GRCm39) E232* probably null Het
Sik2 A G 9: 50,810,058 (GRCm39) F502L possibly damaging Het
Slamf9 A T 1: 172,305,782 (GRCm39) I272F unknown Het
Slc33a1 A T 3: 63,861,424 (GRCm39) D259E probably benign Het
Slc41a3 A G 6: 90,621,138 (GRCm39) I393V probably benign Het
Slk A G 19: 47,608,346 (GRCm39) D433G possibly damaging Het
Spata13 C T 14: 60,929,240 (GRCm39) P266L probably benign Het
Speer4c1 T A 5: 15,916,652 (GRCm39) Q105L probably benign Het
Srgap1 T A 10: 121,761,771 (GRCm39) I126F probably damaging Het
Srgap1 A G 10: 121,628,579 (GRCm39) S818P probably benign Het
Tbpl2 A T 2: 23,981,104 (GRCm39) C232* probably null Het
Tctn3 T G 19: 40,599,743 (GRCm39) N153T possibly damaging Het
Tdrd1 T A 19: 56,847,101 (GRCm39) V914E probably benign Het
Tmem200b A G 4: 131,649,359 (GRCm39) H93R possibly damaging Het
Tmem33 T G 5: 67,425,922 (GRCm39) N155K possibly damaging Het
Tmprss15 T C 16: 78,884,400 (GRCm39) D94G probably benign Het
Tnpo2 A G 8: 85,781,988 (GRCm39) D869G probably benign Het
Traf6 C T 2: 101,527,029 (GRCm39) R260* probably null Het
Ttn C T 2: 76,594,293 (GRCm39) V20552I possibly damaging Het
Vmn2r102 T A 17: 19,898,129 (GRCm39) D381E probably benign Het
Vmn2r92 T C 17: 18,405,201 (GRCm39) F782L possibly damaging Het
Zfc3h1 G A 10: 115,244,821 (GRCm39) D765N possibly damaging Het
Zfp472 T A 17: 33,196,271 (GRCm39) H115Q possibly damaging Het
Zmynd11 T A 13: 9,739,244 (GRCm39) N514I probably benign Het
Other mutations in Casp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Casp1 APN 9 5,299,872 (GRCm39) splice site probably benign
IGL00667:Casp1 APN 9 5,303,756 (GRCm39) missense probably benign 0.40
IGL01998:Casp1 APN 9 5,303,043 (GRCm39) missense probably damaging 1.00
IGL02248:Casp1 APN 9 5,299,452 (GRCm39) missense probably benign 0.01
IGL02469:Casp1 APN 9 5,303,105 (GRCm39) missense probably benign 0.19
P0027:Casp1 UTSW 9 5,299,851 (GRCm39) missense probably benign 0.00
PIT4305001:Casp1 UTSW 9 5,306,135 (GRCm39) missense probably benign 0.03
R0724:Casp1 UTSW 9 5,303,077 (GRCm39) missense probably benign
R1169:Casp1 UTSW 9 5,299,454 (GRCm39) missense possibly damaging 0.93
R1876:Casp1 UTSW 9 5,303,663 (GRCm39) missense probably benign 0.01
R2316:Casp1 UTSW 9 5,306,213 (GRCm39) missense possibly damaging 0.92
R2877:Casp1 UTSW 9 5,303,110 (GRCm39) missense probably damaging 1.00
R2885:Casp1 UTSW 9 5,299,851 (GRCm39) missense probably benign 0.00
R4043:Casp1 UTSW 9 5,302,444 (GRCm39) missense probably benign
R4367:Casp1 UTSW 9 5,299,333 (GRCm39) missense probably benign 0.41
R4656:Casp1 UTSW 9 5,304,324 (GRCm39) missense probably damaging 1.00
R4705:Casp1 UTSW 9 5,306,204 (GRCm39) missense probably damaging 1.00
R4790:Casp1 UTSW 9 5,303,020 (GRCm39) missense probably benign 0.01
R4858:Casp1 UTSW 9 5,306,742 (GRCm39) missense probably damaging 1.00
R5607:Casp1 UTSW 9 5,303,143 (GRCm39) missense probably damaging 1.00
R5784:Casp1 UTSW 9 5,299,337 (GRCm39) missense probably damaging 0.98
R6578:Casp1 UTSW 9 5,304,280 (GRCm39) missense probably benign 0.04
R7111:Casp1 UTSW 9 5,299,816 (GRCm39) missense probably benign 0.01
R7215:Casp1 UTSW 9 5,298,523 (GRCm39) splice site probably null
R7590:Casp1 UTSW 9 5,306,710 (GRCm39) missense probably damaging 1.00
R8002:Casp1 UTSW 9 5,303,164 (GRCm39) missense possibly damaging 0.94
R8510:Casp1 UTSW 9 5,303,026 (GRCm39) missense probably damaging 1.00
R8902:Casp1 UTSW 9 5,299,333 (GRCm39) missense probably benign 0.41
R9234:Casp1 UTSW 9 5,303,128 (GRCm39) missense probably benign 0.04
R9471:Casp1 UTSW 9 5,304,187 (GRCm39) missense probably benign 0.13
T0722:Casp1 UTSW 9 5,299,851 (GRCm39) missense probably benign 0.00
X0003:Casp1 UTSW 9 5,299,851 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGATATGTGCCTCATACTGTATGC -3'
(R):5'- AAAGATTTGGCTTGCCTGGG -3'

Sequencing Primer
(F):5'- ATGTGCCTCATACTGTATGCTTTTG -3'
(R):5'- ATGATCACATAGGTCCCG -3'
Posted On 2022-11-14