Incidental Mutation 'R9747:Atp10b'
ID 732239
Institutional Source Beutler Lab
Gene Symbol Atp10b
Ensembl Gene ENSMUSG00000055415
Gene Name ATPase, class V, type 10B
Synonyms 9030605H24Rik, 5930426O13Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R9747 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 43040704-43153112 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 43088339 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 315 (T315I)
Ref Sequence ENSEMBL: ENSMUSP00000076844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077659]
AlphaFold B1AWN4
Predicted Effect probably benign
Transcript: ENSMUST00000077659
AA Change: T315I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076844
Gene: ENSMUSG00000055415
AA Change: T315I

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 47 118 3.8e-26 PFAM
Pfam:E1-E2_ATPase 123 393 2.9e-7 PFAM
low complexity region 621 638 N/A INTRINSIC
Pfam:Cation_ATPase 692 799 7.1e-9 PFAM
Pfam:HAD 705 1062 6.7e-12 PFAM
Pfam:PhoLip_ATPase_C 1079 1324 1.9e-79 PFAM
low complexity region 1353 1366 N/A INTRINSIC
low complexity region 1457 1471 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,668,711 (GRCm39) S701P probably damaging Het
Acsl1 A G 8: 46,961,397 (GRCm39) K114R probably benign Het
Adam11 A G 11: 102,663,495 (GRCm39) N275D probably damaging Het
Adamts19 G A 18: 59,023,487 (GRCm39) R294H possibly damaging Het
Adamts20 C T 15: 94,180,943 (GRCm39) C1666Y probably damaging Het
Ahnak A T 19: 8,987,541 (GRCm39) I2942L possibly damaging Het
Ank1 A G 8: 23,576,993 (GRCm39) H195R probably damaging Het
Ank2 T C 3: 126,752,667 (GRCm39) T350A probably damaging Het
Asb3 T A 11: 31,008,946 (GRCm39) N243K possibly damaging Het
Avl9 C T 6: 56,730,825 (GRCm39) S583F probably damaging Het
Bclaf1 A G 10: 20,207,892 (GRCm39) K700E possibly damaging Het
Brd10 C A 19: 29,731,911 (GRCm39) C367F possibly damaging Het
Cacna1i G A 15: 80,246,318 (GRCm39) E571K probably benign Het
Casp1 T A 9: 5,299,322 (GRCm39) V17E probably damaging Het
Ccdc115 A T 1: 34,478,001 (GRCm39) D76E probably benign Het
Ccdc150 A T 1: 54,299,107 (GRCm39) R28* probably null Het
Cd36 T G 5: 18,019,732 (GRCm39) E123A probably benign Het
Cd5l A C 3: 87,275,104 (GRCm39) Q214H probably benign Het
Cfap46 T A 7: 139,191,907 (GRCm39) H2370L unknown Het
Cftr C A 6: 18,285,636 (GRCm39) T1148K possibly damaging Het
Col15a1 T A 4: 47,312,208 (GRCm39) L1341Q probably damaging Het
Col6a6 T C 9: 105,661,239 (GRCm39) E290G probably benign Het
D6Wsu163e A G 6: 126,938,977 (GRCm39) E404G probably benign Het
Dchs1 A T 7: 105,412,682 (GRCm39) D1239E probably damaging Het
Dennd4b C T 3: 90,177,828 (GRCm39) T430I possibly damaging Het
Dmgdh C T 13: 93,825,154 (GRCm39) P159L probably damaging Het
Dmrt3 G A 19: 25,600,003 (GRCm39) D283N probably damaging Het
Dnttip1 A G 2: 164,607,100 (GRCm39) D247G probably damaging Het
Efhc1 A T 1: 21,048,928 (GRCm39) D447V probably damaging Het
Ehhadh T C 16: 21,585,138 (GRCm39) K248E probably benign Het
Eif4enif1 T C 11: 3,163,267 (GRCm39) L34P probably damaging Het
Fer T C 17: 64,214,376 (GRCm39) M103T probably benign Het
Gabrg1 T C 5: 70,938,029 (GRCm39) M197V probably damaging Het
Galnt5 C A 2: 57,889,477 (GRCm39) T359K probably benign Het
Gm8108 G T 14: 4,110,527 (GRCm38) probably benign Het
Gna12 T C 5: 140,746,602 (GRCm39) N281S probably damaging Het
Golgb1 C T 16: 36,713,769 (GRCm39) T250I probably damaging Het
Gpd1 A G 15: 99,618,004 (GRCm39) K130E probably benign Het
Gys2 A T 6: 142,395,181 (GRCm39) M428K possibly damaging Het
Hey2 A C 10: 30,709,824 (GRCm39) S310A probably benign Het
Ifi47 T C 11: 48,987,367 (GRCm39) V378A possibly damaging Het
Ighv8-12 A G 12: 115,611,640 (GRCm39) S95P probably damaging Het
Igkv1-131 G T 6: 67,743,215 (GRCm39) T56K probably damaging Het
Igsf23 T C 7: 19,675,839 (GRCm39) N127S probably benign Het
Iqgap2 T A 13: 95,821,505 (GRCm39) N546I probably damaging Het
Irf9 A G 14: 55,844,045 (GRCm39) H270R probably benign Het
Itga6 C T 2: 71,656,871 (GRCm39) S375L probably damaging Het
Jak1 T C 4: 101,016,087 (GRCm39) E857G probably benign Het
Kbtbd8 A G 6: 95,098,838 (GRCm39) T116A possibly damaging Het
Kif5a T C 10: 127,074,622 (GRCm39) I570V probably benign Het
Klhdc10 T C 6: 30,439,859 (GRCm39) M154T possibly damaging Het
Krtap6-2 A G 16: 89,216,776 (GRCm39) Y64H unknown Het
Lce1l C T 3: 92,757,828 (GRCm39) C10Y unknown Het
Lrrc72 A G 12: 36,264,371 (GRCm39) Y29H probably damaging Het
Ltbp2 A T 12: 84,915,515 (GRCm39) N181K probably damaging Het
Ly75 A G 2: 60,136,672 (GRCm39) probably null Het
Mpped1 A G 15: 83,684,305 (GRCm39) Y109C probably damaging Het
Mrgpra2a C T 7: 47,076,458 (GRCm39) V267I probably benign Het
Muc4 T A 16: 32,754,698 (GRCm38) V1524E probably benign Het
Nabp2 T A 10: 128,237,610 (GRCm39) R208* probably null Het
Ndst3 A G 3: 123,340,461 (GRCm39) F786L possibly damaging Het
Nos2 C T 11: 78,822,472 (GRCm39) P123S probably damaging Het
Nrcam T A 12: 44,645,192 (GRCm39) V1198E probably damaging Het
Oacyl A G 18: 65,880,962 (GRCm39) Q592R possibly damaging Het
Or10ak9 C T 4: 118,726,217 (GRCm39) P80S probably damaging Het
Or5as1 T A 2: 86,980,898 (GRCm39) T36S probably benign Het
Pcdhgc4 A G 18: 37,951,026 (GRCm39) Y814C probably benign Het
Pcm1 A C 8: 41,757,135 (GRCm39) H1349P probably benign Het
Pcsk6 T A 7: 65,633,470 (GRCm39) D567E probably damaging Het
Pdgfd T C 9: 6,337,310 (GRCm39) V214A probably benign Het
Plekhg3 A T 12: 76,611,367 (GRCm39) N270I probably damaging Het
Rasgrf1 T A 9: 89,877,047 (GRCm39) V804E probably benign Het
Rbl1 G T 2: 157,033,966 (GRCm39) L371I probably damaging Het
Rcl1 T A 19: 29,105,482 (GRCm39) I223N probably damaging Het
Saa4 C T 7: 46,381,077 (GRCm39) G15E probably damaging Het
Selenbp1 T C 3: 94,844,648 (GRCm39) S102P probably damaging Het
Setx G T 2: 29,064,377 (GRCm39) E232* probably null Het
Sik2 A G 9: 50,810,058 (GRCm39) F502L possibly damaging Het
Slamf9 A T 1: 172,305,782 (GRCm39) I272F unknown Het
Slc33a1 A T 3: 63,861,424 (GRCm39) D259E probably benign Het
Slc41a3 A G 6: 90,621,138 (GRCm39) I393V probably benign Het
Slk A G 19: 47,608,346 (GRCm39) D433G possibly damaging Het
Spata13 C T 14: 60,929,240 (GRCm39) P266L probably benign Het
Speer4c1 T A 5: 15,916,652 (GRCm39) Q105L probably benign Het
Srgap1 T A 10: 121,761,771 (GRCm39) I126F probably damaging Het
Srgap1 A G 10: 121,628,579 (GRCm39) S818P probably benign Het
Tbpl2 A T 2: 23,981,104 (GRCm39) C232* probably null Het
Tctn3 T G 19: 40,599,743 (GRCm39) N153T possibly damaging Het
Tdrd1 T A 19: 56,847,101 (GRCm39) V914E probably benign Het
Tmem200b A G 4: 131,649,359 (GRCm39) H93R possibly damaging Het
Tmem33 T G 5: 67,425,922 (GRCm39) N155K possibly damaging Het
Tmprss15 T C 16: 78,884,400 (GRCm39) D94G probably benign Het
Tnpo2 A G 8: 85,781,988 (GRCm39) D869G probably benign Het
Traf6 C T 2: 101,527,029 (GRCm39) R260* probably null Het
Ttn C T 2: 76,594,293 (GRCm39) V20552I possibly damaging Het
Vmn2r102 T A 17: 19,898,129 (GRCm39) D381E probably benign Het
Vmn2r92 T C 17: 18,405,201 (GRCm39) F782L possibly damaging Het
Zfc3h1 G A 10: 115,244,821 (GRCm39) D765N possibly damaging Het
Zfp472 T A 17: 33,196,271 (GRCm39) H115Q possibly damaging Het
Zmynd11 T A 13: 9,739,244 (GRCm39) N514I probably benign Het
Other mutations in Atp10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Atp10b APN 11 43,092,988 (GRCm39) missense probably damaging 1.00
IGL01385:Atp10b APN 11 43,125,256 (GRCm39) missense probably damaging 1.00
IGL01524:Atp10b APN 11 43,150,672 (GRCm39) missense probably benign 0.18
IGL01575:Atp10b APN 11 43,063,548 (GRCm39) missense probably benign 0.00
IGL01588:Atp10b APN 11 43,063,548 (GRCm39) missense probably benign 0.00
IGL01590:Atp10b APN 11 43,063,548 (GRCm39) missense probably benign 0.00
IGL01832:Atp10b APN 11 43,125,262 (GRCm39) missense probably damaging 0.98
IGL01927:Atp10b APN 11 43,150,231 (GRCm39) splice site probably benign
IGL01933:Atp10b APN 11 43,085,457 (GRCm39) missense probably damaging 1.00
IGL02182:Atp10b APN 11 43,139,774 (GRCm39) missense probably damaging 1.00
IGL02215:Atp10b APN 11 43,085,492 (GRCm39) critical splice donor site probably null
IGL02216:Atp10b APN 11 43,150,616 (GRCm39) missense probably damaging 0.98
IGL02973:Atp10b APN 11 43,088,336 (GRCm39) missense probably damaging 1.00
IGL03012:Atp10b APN 11 43,085,482 (GRCm39) missense probably damaging 0.99
IGL03106:Atp10b APN 11 43,138,304 (GRCm39) missense probably benign 0.32
IGL03123:Atp10b APN 11 43,044,110 (GRCm39) missense probably benign 0.01
IGL03202:Atp10b APN 11 43,125,268 (GRCm39) critical splice donor site probably null
IGL03339:Atp10b APN 11 43,121,442 (GRCm39) missense probably null 0.71
R0053:Atp10b UTSW 11 43,107,391 (GRCm39) splice site probably benign
R0053:Atp10b UTSW 11 43,107,391 (GRCm39) splice site probably benign
R0098:Atp10b UTSW 11 43,080,431 (GRCm39) missense probably benign 0.00
R0098:Atp10b UTSW 11 43,080,431 (GRCm39) missense probably benign 0.00
R0281:Atp10b UTSW 11 43,044,131 (GRCm39) missense probably benign 0.00
R0379:Atp10b UTSW 11 43,145,141 (GRCm39) missense probably benign 0.05
R0380:Atp10b UTSW 11 43,116,424 (GRCm39) missense probably damaging 1.00
R0470:Atp10b UTSW 11 43,093,866 (GRCm39) missense possibly damaging 0.88
R1355:Atp10b UTSW 11 43,042,482 (GRCm39) nonsense probably null
R1368:Atp10b UTSW 11 43,092,981 (GRCm39) missense probably damaging 1.00
R1370:Atp10b UTSW 11 43,042,482 (GRCm39) nonsense probably null
R1413:Atp10b UTSW 11 43,121,391 (GRCm39) missense probably benign 0.00
R1502:Atp10b UTSW 11 43,121,174 (GRCm39) missense probably damaging 1.00
R1530:Atp10b UTSW 11 43,088,351 (GRCm39) missense probably benign 0.03
R1596:Atp10b UTSW 11 43,126,594 (GRCm39) missense probably damaging 1.00
R1675:Atp10b UTSW 11 43,116,475 (GRCm39) missense probably damaging 1.00
R1880:Atp10b UTSW 11 43,150,259 (GRCm39) missense probably damaging 1.00
R1938:Atp10b UTSW 11 43,121,245 (GRCm39) missense probably benign 0.00
R1986:Atp10b UTSW 11 43,063,595 (GRCm39) missense probably benign 0.12
R2081:Atp10b UTSW 11 43,092,955 (GRCm39) missense probably damaging 1.00
R2083:Atp10b UTSW 11 43,103,250 (GRCm39) missense probably benign 0.24
R2159:Atp10b UTSW 11 43,042,680 (GRCm39) missense possibly damaging 0.81
R2255:Atp10b UTSW 11 43,125,207 (GRCm39) missense probably damaging 1.00
R2259:Atp10b UTSW 11 43,080,440 (GRCm39) missense probably damaging 1.00
R2259:Atp10b UTSW 11 43,063,572 (GRCm39) missense probably damaging 1.00
R3741:Atp10b UTSW 11 43,126,489 (GRCm39) missense probably damaging 1.00
R3942:Atp10b UTSW 11 43,063,581 (GRCm39) missense probably damaging 1.00
R3971:Atp10b UTSW 11 43,107,339 (GRCm39) missense probably damaging 1.00
R4007:Atp10b UTSW 11 43,150,679 (GRCm39) missense probably benign 0.04
R4050:Atp10b UTSW 11 43,150,363 (GRCm39) missense probably benign 0.00
R4078:Atp10b UTSW 11 43,044,110 (GRCm39) missense probably benign 0.01
R4567:Atp10b UTSW 11 43,088,384 (GRCm39) missense probably benign 0.03
R4651:Atp10b UTSW 11 43,085,472 (GRCm39) missense probably damaging 1.00
R4652:Atp10b UTSW 11 43,085,472 (GRCm39) missense probably damaging 1.00
R4667:Atp10b UTSW 11 43,138,345 (GRCm39) missense probably damaging 1.00
R4720:Atp10b UTSW 11 43,093,949 (GRCm39) missense probably benign
R4987:Atp10b UTSW 11 43,042,440 (GRCm39) utr 5 prime probably benign
R5232:Atp10b UTSW 11 43,093,006 (GRCm39) missense probably damaging 1.00
R5233:Atp10b UTSW 11 43,121,387 (GRCm39) missense probably benign 0.06
R5281:Atp10b UTSW 11 43,145,163 (GRCm39) missense probably damaging 0.97
R5307:Atp10b UTSW 11 43,103,302 (GRCm39) missense probably damaging 1.00
R5460:Atp10b UTSW 11 43,121,282 (GRCm39) missense probably benign 0.00
R5518:Atp10b UTSW 11 43,042,463 (GRCm39) missense possibly damaging 0.84
R5659:Atp10b UTSW 11 43,136,252 (GRCm39) missense probably damaging 1.00
R5688:Atp10b UTSW 11 43,092,000 (GRCm39) missense probably benign 0.00
R5735:Atp10b UTSW 11 43,042,601 (GRCm39) missense probably benign 0.00
R6153:Atp10b UTSW 11 43,145,109 (GRCm39) missense probably damaging 1.00
R6251:Atp10b UTSW 11 43,126,573 (GRCm39) missense possibly damaging 0.95
R6259:Atp10b UTSW 11 43,092,065 (GRCm39) missense probably benign 0.24
R6394:Atp10b UTSW 11 43,116,464 (GRCm39) missense probably damaging 1.00
R6492:Atp10b UTSW 11 43,109,784 (GRCm39) missense probably damaging 1.00
R6769:Atp10b UTSW 11 43,094,079 (GRCm39) critical splice donor site probably null
R6771:Atp10b UTSW 11 43,094,079 (GRCm39) critical splice donor site probably null
R6775:Atp10b UTSW 11 43,113,040 (GRCm39) missense possibly damaging 0.80
R7134:Atp10b UTSW 11 43,136,291 (GRCm39) missense probably damaging 1.00
R7322:Atp10b UTSW 11 43,103,374 (GRCm39) missense probably damaging 1.00
R7367:Atp10b UTSW 11 43,138,328 (GRCm39) missense probably damaging 1.00
R7538:Atp10b UTSW 11 43,116,373 (GRCm39) missense probably benign 0.04
R7708:Atp10b UTSW 11 43,092,970 (GRCm39) missense probably damaging 1.00
R7787:Atp10b UTSW 11 43,150,700 (GRCm39) missense possibly damaging 0.91
R8145:Atp10b UTSW 11 43,092,949 (GRCm39) missense probably damaging 1.00
R8406:Atp10b UTSW 11 43,093,984 (GRCm39) missense probably benign 0.00
R8503:Atp10b UTSW 11 43,113,066 (GRCm39) missense possibly damaging 0.92
R8542:Atp10b UTSW 11 43,121,208 (GRCm39) missense probably benign 0.18
R8744:Atp10b UTSW 11 43,121,177 (GRCm39) missense probably damaging 1.00
R8815:Atp10b UTSW 11 43,093,978 (GRCm39) missense possibly damaging 0.63
R8833:Atp10b UTSW 11 43,112,986 (GRCm39) missense probably damaging 1.00
R8880:Atp10b UTSW 11 43,106,811 (GRCm39) missense probably benign
R8989:Atp10b UTSW 11 43,136,269 (GRCm39) nonsense probably null
R8998:Atp10b UTSW 11 43,150,726 (GRCm39) makesense probably null
R9255:Atp10b UTSW 11 43,107,148 (GRCm39) missense probably damaging 1.00
R9281:Atp10b UTSW 11 43,116,458 (GRCm39) missense probably benign 0.11
R9345:Atp10b UTSW 11 43,094,024 (GRCm39) missense probably damaging 0.99
R9357:Atp10b UTSW 11 43,150,711 (GRCm39) missense probably benign 0.18
R9393:Atp10b UTSW 11 43,063,608 (GRCm39) missense probably damaging 1.00
R9516:Atp10b UTSW 11 43,121,224 (GRCm39) missense probably benign 0.02
R9644:Atp10b UTSW 11 43,042,659 (GRCm39) missense probably damaging 1.00
Z1177:Atp10b UTSW 11 43,044,176 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GATGACTGACTATGTGAGGCCTC -3'
(R):5'- TCATGGTACCCCACTAAAGTAGG -3'

Sequencing Primer
(F):5'- GACTATGTGAGGCCTCTGCTAC -3'
(R):5'- CCACTAAAGTAGGCAATATGGACTTG -3'
Posted On 2022-11-14