Incidental Mutation 'R9747:Ifi47'
ID 732240
Institutional Source Beutler Lab
Gene Symbol Ifi47
Ensembl Gene ENSMUSG00000078920
Gene Name interferon gamma inducible protein 47
Synonyms 47kDa, IRG-47, Igrd, Iigp4
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R9747 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 48967414-48987801 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 48987367 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 378 (V378A)
Ref Sequence ENSEMBL: ENSMUSP00000041975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046704] [ENSMUST00000056759] [ENSMUST00000102785] [ENSMUST00000109202] [ENSMUST00000152914] [ENSMUST00000179282] [ENSMUST00000203149] [ENSMUST00000203810] [ENSMUST00000213728] [ENSMUST00000214804]
AlphaFold Q61635
Predicted Effect possibly damaging
Transcript: ENSMUST00000046704
AA Change: V378A

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041975
Gene: ENSMUSG00000078920
AA Change: V378A

DomainStartEndE-ValueType
Pfam:IIGP 40 414 1.7e-177 PFAM
Pfam:MMR_HSR1 76 219 9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056759
SMART Domains Protein: ENSMUSP00000058544
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 1.5e-33 PFAM
Pfam:7tm_4 108 252 1.7e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102785
SMART Domains Protein: ENSMUSP00000099846
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 1.5e-33 PFAM
Pfam:7tm_4 108 252 1.7e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109202
AA Change: V378A

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104825
Gene: ENSMUSG00000078920
AA Change: V378A

DomainStartEndE-ValueType
Pfam:IIGP 40 414 3.1e-175 PFAM
Pfam:Miro 76 191 2.4e-6 PFAM
Pfam:MMR_HSR1 76 211 3.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152914
Predicted Effect probably benign
Transcript: ENSMUST00000179282
SMART Domains Protein: ENSMUSP00000136647
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7tm_4 1 276 3.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 3.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203149
SMART Domains Protein: ENSMUSP00000145429
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 253 3.8e-7 PFAM
Pfam:7tm_1 42 291 2.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203810
SMART Domains Protein: ENSMUSP00000144951
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 253 3.8e-7 PFAM
Pfam:7tm_1 42 291 2.5e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213728
AA Change: V378A

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000214804
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: In the absence of infection, mice show no overt phenotype. Resistance to protozoan parasitic infection is impaired in homozygous mutant mice, whereas resistance to bacterial and viral infection are normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,668,711 (GRCm39) S701P probably damaging Het
Acsl1 A G 8: 46,961,397 (GRCm39) K114R probably benign Het
Adam11 A G 11: 102,663,495 (GRCm39) N275D probably damaging Het
Adamts19 G A 18: 59,023,487 (GRCm39) R294H possibly damaging Het
Adamts20 C T 15: 94,180,943 (GRCm39) C1666Y probably damaging Het
Ahnak A T 19: 8,987,541 (GRCm39) I2942L possibly damaging Het
Ank1 A G 8: 23,576,993 (GRCm39) H195R probably damaging Het
Ank2 T C 3: 126,752,667 (GRCm39) T350A probably damaging Het
Asb3 T A 11: 31,008,946 (GRCm39) N243K possibly damaging Het
Atp10b C T 11: 43,088,339 (GRCm39) T315I probably benign Het
Avl9 C T 6: 56,730,825 (GRCm39) S583F probably damaging Het
Bclaf1 A G 10: 20,207,892 (GRCm39) K700E possibly damaging Het
Brd10 C A 19: 29,731,911 (GRCm39) C367F possibly damaging Het
Cacna1i G A 15: 80,246,318 (GRCm39) E571K probably benign Het
Casp1 T A 9: 5,299,322 (GRCm39) V17E probably damaging Het
Ccdc115 A T 1: 34,478,001 (GRCm39) D76E probably benign Het
Ccdc150 A T 1: 54,299,107 (GRCm39) R28* probably null Het
Cd36 T G 5: 18,019,732 (GRCm39) E123A probably benign Het
Cd5l A C 3: 87,275,104 (GRCm39) Q214H probably benign Het
Cfap46 T A 7: 139,191,907 (GRCm39) H2370L unknown Het
Cftr C A 6: 18,285,636 (GRCm39) T1148K possibly damaging Het
Col15a1 T A 4: 47,312,208 (GRCm39) L1341Q probably damaging Het
Col6a6 T C 9: 105,661,239 (GRCm39) E290G probably benign Het
D6Wsu163e A G 6: 126,938,977 (GRCm39) E404G probably benign Het
Dchs1 A T 7: 105,412,682 (GRCm39) D1239E probably damaging Het
Dennd4b C T 3: 90,177,828 (GRCm39) T430I possibly damaging Het
Dmgdh C T 13: 93,825,154 (GRCm39) P159L probably damaging Het
Dmrt3 G A 19: 25,600,003 (GRCm39) D283N probably damaging Het
Dnttip1 A G 2: 164,607,100 (GRCm39) D247G probably damaging Het
Efhc1 A T 1: 21,048,928 (GRCm39) D447V probably damaging Het
Ehhadh T C 16: 21,585,138 (GRCm39) K248E probably benign Het
Eif4enif1 T C 11: 3,163,267 (GRCm39) L34P probably damaging Het
Fer T C 17: 64,214,376 (GRCm39) M103T probably benign Het
Gabrg1 T C 5: 70,938,029 (GRCm39) M197V probably damaging Het
Galnt5 C A 2: 57,889,477 (GRCm39) T359K probably benign Het
Gm8108 G T 14: 4,110,527 (GRCm38) probably benign Het
Gna12 T C 5: 140,746,602 (GRCm39) N281S probably damaging Het
Golgb1 C T 16: 36,713,769 (GRCm39) T250I probably damaging Het
Gpd1 A G 15: 99,618,004 (GRCm39) K130E probably benign Het
Gys2 A T 6: 142,395,181 (GRCm39) M428K possibly damaging Het
Hey2 A C 10: 30,709,824 (GRCm39) S310A probably benign Het
Ighv8-12 A G 12: 115,611,640 (GRCm39) S95P probably damaging Het
Igkv1-131 G T 6: 67,743,215 (GRCm39) T56K probably damaging Het
Igsf23 T C 7: 19,675,839 (GRCm39) N127S probably benign Het
Iqgap2 T A 13: 95,821,505 (GRCm39) N546I probably damaging Het
Irf9 A G 14: 55,844,045 (GRCm39) H270R probably benign Het
Itga6 C T 2: 71,656,871 (GRCm39) S375L probably damaging Het
Jak1 T C 4: 101,016,087 (GRCm39) E857G probably benign Het
Kbtbd8 A G 6: 95,098,838 (GRCm39) T116A possibly damaging Het
Kif5a T C 10: 127,074,622 (GRCm39) I570V probably benign Het
Klhdc10 T C 6: 30,439,859 (GRCm39) M154T possibly damaging Het
Krtap6-2 A G 16: 89,216,776 (GRCm39) Y64H unknown Het
Lce1l C T 3: 92,757,828 (GRCm39) C10Y unknown Het
Lrrc72 A G 12: 36,264,371 (GRCm39) Y29H probably damaging Het
Ltbp2 A T 12: 84,915,515 (GRCm39) N181K probably damaging Het
Ly75 A G 2: 60,136,672 (GRCm39) probably null Het
Mpped1 A G 15: 83,684,305 (GRCm39) Y109C probably damaging Het
Mrgpra2a C T 7: 47,076,458 (GRCm39) V267I probably benign Het
Muc4 T A 16: 32,754,698 (GRCm38) V1524E probably benign Het
Nabp2 T A 10: 128,237,610 (GRCm39) R208* probably null Het
Ndst3 A G 3: 123,340,461 (GRCm39) F786L possibly damaging Het
Nos2 C T 11: 78,822,472 (GRCm39) P123S probably damaging Het
Nrcam T A 12: 44,645,192 (GRCm39) V1198E probably damaging Het
Oacyl A G 18: 65,880,962 (GRCm39) Q592R possibly damaging Het
Or10ak9 C T 4: 118,726,217 (GRCm39) P80S probably damaging Het
Or5as1 T A 2: 86,980,898 (GRCm39) T36S probably benign Het
Pcdhgc4 A G 18: 37,951,026 (GRCm39) Y814C probably benign Het
Pcm1 A C 8: 41,757,135 (GRCm39) H1349P probably benign Het
Pcsk6 T A 7: 65,633,470 (GRCm39) D567E probably damaging Het
Pdgfd T C 9: 6,337,310 (GRCm39) V214A probably benign Het
Plekhg3 A T 12: 76,611,367 (GRCm39) N270I probably damaging Het
Rasgrf1 T A 9: 89,877,047 (GRCm39) V804E probably benign Het
Rbl1 G T 2: 157,033,966 (GRCm39) L371I probably damaging Het
Rcl1 T A 19: 29,105,482 (GRCm39) I223N probably damaging Het
Saa4 C T 7: 46,381,077 (GRCm39) G15E probably damaging Het
Selenbp1 T C 3: 94,844,648 (GRCm39) S102P probably damaging Het
Setx G T 2: 29,064,377 (GRCm39) E232* probably null Het
Sik2 A G 9: 50,810,058 (GRCm39) F502L possibly damaging Het
Slamf9 A T 1: 172,305,782 (GRCm39) I272F unknown Het
Slc33a1 A T 3: 63,861,424 (GRCm39) D259E probably benign Het
Slc41a3 A G 6: 90,621,138 (GRCm39) I393V probably benign Het
Slk A G 19: 47,608,346 (GRCm39) D433G possibly damaging Het
Spata13 C T 14: 60,929,240 (GRCm39) P266L probably benign Het
Speer4c1 T A 5: 15,916,652 (GRCm39) Q105L probably benign Het
Srgap1 T A 10: 121,761,771 (GRCm39) I126F probably damaging Het
Srgap1 A G 10: 121,628,579 (GRCm39) S818P probably benign Het
Tbpl2 A T 2: 23,981,104 (GRCm39) C232* probably null Het
Tctn3 T G 19: 40,599,743 (GRCm39) N153T possibly damaging Het
Tdrd1 T A 19: 56,847,101 (GRCm39) V914E probably benign Het
Tmem200b A G 4: 131,649,359 (GRCm39) H93R possibly damaging Het
Tmem33 T G 5: 67,425,922 (GRCm39) N155K possibly damaging Het
Tmprss15 T C 16: 78,884,400 (GRCm39) D94G probably benign Het
Tnpo2 A G 8: 85,781,988 (GRCm39) D869G probably benign Het
Traf6 C T 2: 101,527,029 (GRCm39) R260* probably null Het
Ttn C T 2: 76,594,293 (GRCm39) V20552I possibly damaging Het
Vmn2r102 T A 17: 19,898,129 (GRCm39) D381E probably benign Het
Vmn2r92 T C 17: 18,405,201 (GRCm39) F782L possibly damaging Het
Zfc3h1 G A 10: 115,244,821 (GRCm39) D765N possibly damaging Het
Zfp472 T A 17: 33,196,271 (GRCm39) H115Q possibly damaging Het
Zmynd11 T A 13: 9,739,244 (GRCm39) N514I probably benign Het
Other mutations in Ifi47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Ifi47 APN 11 48,986,241 (GRCm39) nonsense probably null
IGL00811:Ifi47 APN 11 48,986,244 (GRCm39) missense probably benign 0.00
IGL02451:Ifi47 APN 11 48,986,604 (GRCm39) missense probably damaging 1.00
IGL02468:Ifi47 APN 11 48,986,810 (GRCm39) missense probably damaging 0.98
IGL02902:Ifi47 APN 11 48,986,617 (GRCm39) missense probably benign 0.00
IGL03260:Ifi47 APN 11 48,986,932 (GRCm39) missense probably damaging 0.99
R0111:Ifi47 UTSW 11 48,986,897 (GRCm39) missense probably damaging 1.00
R0636:Ifi47 UTSW 11 48,987,478 (GRCm39) missense possibly damaging 0.85
R1548:Ifi47 UTSW 11 48,986,698 (GRCm39) missense probably damaging 1.00
R2255:Ifi47 UTSW 11 48,987,474 (GRCm39) missense probably benign 0.02
R3703:Ifi47 UTSW 11 48,986,352 (GRCm39) missense probably benign 0.01
R5071:Ifi47 UTSW 11 48,986,361 (GRCm39) missense probably benign 0.01
R5073:Ifi47 UTSW 11 48,986,361 (GRCm39) missense probably benign 0.01
R5074:Ifi47 UTSW 11 48,986,361 (GRCm39) missense probably benign 0.01
R5262:Ifi47 UTSW 11 48,986,559 (GRCm39) missense probably benign 0.00
R5902:Ifi47 UTSW 11 48,986,213 (GRCm39) splice site probably null
R6745:Ifi47 UTSW 11 48,986,329 (GRCm39) missense probably benign 0.38
R7155:Ifi47 UTSW 11 48,987,369 (GRCm39) missense probably benign 0.39
R7535:Ifi47 UTSW 11 48,987,452 (GRCm39) missense probably damaging 1.00
R8330:Ifi47 UTSW 11 48,986,637 (GRCm39) missense possibly damaging 0.55
R8412:Ifi47 UTSW 11 48,986,425 (GRCm39) missense probably damaging 0.98
R9076:Ifi47 UTSW 11 48,986,842 (GRCm39) missense probably benign
R9487:Ifi47 UTSW 11 48,986,620 (GRCm39) missense probably damaging 1.00
Z1177:Ifi47 UTSW 11 48,987,102 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTGCCTGAACAAGAACAGTG -3'
(R):5'- TGGTGGAAGGACAACCAACC -3'

Sequencing Primer
(F):5'- TGCTTGAAGGATTACCGAAGC -3'
(R):5'- ACCCCATTGCCAATTTGGAC -3'
Posted On 2022-11-14