Incidental Mutation 'R9747:Nos2'
ID 732241
Institutional Source Beutler Lab
Gene Symbol Nos2
Ensembl Gene ENSMUSG00000020826
Gene Name nitric oxide synthase 2, inducible
Synonyms iNOS, Nos-2, Nos2a, NOS-II
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9747 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 78920787-78960254 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 78931646 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 123 (P123S)
Ref Sequence ENSEMBL: ENSMUSP00000018610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018610] [ENSMUST00000214397]
AlphaFold P29477
PDB Structure MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DOMAIN (DELTA 114) (N-[(1,3-BENZODIOXOL-5-YL)METHYL]-1-[2-(1H-IMIDAZOL-1-YL)PYRIMIDIN-4-YL]-4-(METHOXYCARBONYL)-PIPERAZINE-2-ACETAMIDE COMPLEX [X-RAY DIFFRACTION]
MURINE INOSOXY DIMER WITH ISOTHIOUREA BOUND IN THE ACTIVE SITE [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND 4-AMINO TETRAHYDROBIOPTERIN [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND DIHYDROBIOPTERIN [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND TETRAHYDROBIOPTERIN [X-RAY DIFFRACTION]
Murine Inducible Nitric Oxide Synthase Oxygenase Dimer (Delta 65) with W457F Mutation at Tetrahydrobiopterin Binding Site [X-RAY DIFFRACTION]
Murine Inducible Nitric Oxide Synthase Oxygenase Dimer (Delta 65) with W457A Mutation at Tetrahydrobiopterin Binding Site [X-RAY DIFFRACTION]
inducible nitric oxide synthase with Chlorzoxazone bound [X-RAY DIFFRACTION]
inducible nitric oxide synthase with 7-nitroindazole bound [X-RAY DIFFRACTION]
inducible nitric oxide synthase with 6-nitroindazole bound [X-RAY DIFFRACTION]
>> 40 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000018610
AA Change: P123S

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000018610
Gene: ENSMUSG00000020826
AA Change: P123S

DomainStartEndE-ValueType
Pfam:NO_synthase 129 491 6.7e-189 PFAM
Pfam:Flavodoxin_1 535 666 5.5e-43 PFAM
Pfam:FAD_binding_1 719 941 8.8e-79 PFAM
Pfam:NAD_binding_1 973 1087 4.1e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214397
AA Change: P10S

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. This gene encodes a nitric oxide synthase that is inducible by a combination of lipopolysaccharide and certain cytokines. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous deletion of this gene alters susceptibility to infection, response to injury, sepsis and sensory stimuli, cardiac function, osteoclast, platelet and mammary gland physiology, tumor growth, testis and uterus morphology, diet-induced atherosclerosis, and blood, urine and glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,850,847 S701P probably damaging Het
9930021J03Rik C A 19: 29,754,511 C367F possibly damaging Het
Acsl1 A G 8: 46,508,360 K114R probably benign Het
Adam11 A G 11: 102,772,669 N275D probably damaging Het
Adamts19 G A 18: 58,890,415 R294H possibly damaging Het
Adamts20 C T 15: 94,283,062 C1666Y probably damaging Het
Ahnak A T 19: 9,010,177 I2942L possibly damaging Het
Ank1 A G 8: 23,086,977 H195R probably damaging Het
Ank2 T C 3: 126,959,018 T350A probably damaging Het
Asb3 T A 11: 31,058,946 N243K possibly damaging Het
Atp10b C T 11: 43,197,512 T315I probably benign Het
Avl9 C T 6: 56,753,840 S583F probably damaging Het
Bclaf1 A G 10: 20,332,146 K700E possibly damaging Het
Cacna1i G A 15: 80,362,117 E571K probably benign Het
Casp1 T A 9: 5,299,322 V17E probably damaging Het
Ccdc115 A T 1: 34,438,920 D76E probably benign Het
Ccdc150 A T 1: 54,259,948 R28* probably null Het
Cd36 T G 5: 17,814,734 E123A probably benign Het
Cd5l A C 3: 87,367,797 Q214H probably benign Het
Cfap46 T A 7: 139,611,991 H2370L unknown Het
Cftr C A 6: 18,285,637 T1148K possibly damaging Het
Col15a1 T A 4: 47,312,208 L1341Q probably damaging Het
Col6a6 T C 9: 105,784,040 E290G probably benign Het
D6Wsu163e A G 6: 126,962,014 E404G probably benign Het
Dchs1 A T 7: 105,763,475 D1239E probably damaging Het
Dennd4b C T 3: 90,270,521 T430I possibly damaging Het
Dmgdh C T 13: 93,688,646 P159L probably damaging Het
Dmrt3 G A 19: 25,622,639 D283N probably damaging Het
Dnttip1 A G 2: 164,765,180 D247G probably damaging Het
Efhc1 A T 1: 20,978,704 D447V probably damaging Het
Ehhadh T C 16: 21,766,388 K248E probably benign Het
Eif4enif1 T C 11: 3,213,267 L34P probably damaging Het
Fer T C 17: 63,907,381 M103T probably benign Het
Gabrg1 T C 5: 70,780,686 M197V probably damaging Het
Galnt5 C A 2: 57,999,465 T359K probably benign Het
Gm8108 G T 14: 4,110,527 probably benign Het
Gna12 T C 5: 140,760,847 N281S probably damaging Het
Golgb1 C T 16: 36,893,407 T250I probably damaging Het
Gpd1 A G 15: 99,720,123 K130E probably benign Het
Gys2 A T 6: 142,449,455 M428K possibly damaging Het
Hey2 A C 10: 30,833,828 S310A probably benign Het
Ifi47 T C 11: 49,096,540 V378A possibly damaging Het
Ighv8-12 A G 12: 115,648,020 S95P probably damaging Het
Igkv1-131 G T 6: 67,766,231 T56K probably damaging Het
Igsf23 T C 7: 19,941,914 N127S probably benign Het
Iqgap2 T A 13: 95,684,997 N546I probably damaging Het
Irf9 A G 14: 55,606,588 H270R probably benign Het
Itga6 C T 2: 71,826,527 S375L probably damaging Het
Jak1 T C 4: 101,158,890 E857G probably benign Het
Kbtbd8 A G 6: 95,121,857 T116A possibly damaging Het
Kif5a T C 10: 127,238,753 I570V probably benign Het
Klhdc10 T C 6: 30,439,860 M154T possibly damaging Het
Krtap6-2 A G 16: 89,419,888 Y64H unknown Het
Lce1l C T 3: 92,850,521 C10Y unknown Het
Lrrc72 A G 12: 36,214,372 Y29H probably damaging Het
Ltbp2 A T 12: 84,868,741 N181K probably damaging Het
Ly75 A G 2: 60,306,328 probably null Het
Mpped1 A G 15: 83,800,104 Y109C probably damaging Het
Mrgpra2a C T 7: 47,426,710 V267I probably benign Het
Muc4 T A 16: 32,754,698 V1524E probably benign Het
Nabp2 T A 10: 128,401,741 R208* probably null Het
Ndst3 A G 3: 123,546,812 F786L possibly damaging Het
Nrcam T A 12: 44,598,409 V1198E probably damaging Het
Oacyl A G 18: 65,747,891 Q592R possibly damaging Het
Olfr1111 T A 2: 87,150,554 T36S probably benign Het
Olfr1331 C T 4: 118,869,020 P80S probably damaging Het
Pcdhgc4 A G 18: 37,817,973 Y814C probably benign Het
Pcm1 A C 8: 41,304,098 H1349P probably benign Het
Pcsk6 T A 7: 65,983,722 D567E probably damaging Het
Pdgfd T C 9: 6,337,310 V214A probably benign Het
Plekhg3 A T 12: 76,564,593 N270I probably damaging Het
Rasgrf1 T A 9: 89,994,994 V804E probably benign Het
Rbl1 G T 2: 157,192,046 L371I probably damaging Het
Rcl1 T A 19: 29,128,082 I223N probably damaging Het
Saa4 C T 7: 46,731,653 G15E probably damaging Het
Selenbp1 T C 3: 94,937,337 S102P probably damaging Het
Setx G T 2: 29,174,365 E232* probably null Het
Sik2 A G 9: 50,898,758 F502L possibly damaging Het
Slamf9 A T 1: 172,478,215 I272F unknown Het
Slc33a1 A T 3: 63,954,003 D259E probably benign Het
Slc41a3 A G 6: 90,644,156 I393V probably benign Het
Slk A G 19: 47,619,907 D433G possibly damaging Het
Spata13 C T 14: 60,691,791 P266L probably benign Het
Speer4c T A 5: 15,711,654 Q105L probably benign Het
Srgap1 A G 10: 121,792,674 S818P probably benign Het
Srgap1 T A 10: 121,925,866 I126F probably damaging Het
Tbpl2 A T 2: 24,091,092 C232* probably null Het
Tctn3 T G 19: 40,611,299 N153T possibly damaging Het
Tdrd1 T A 19: 56,858,669 V914E probably benign Het
Tmem200b A G 4: 131,922,048 H93R possibly damaging Het
Tmem33 T G 5: 67,268,579 N155K possibly damaging Het
Tmprss15 T C 16: 79,087,512 D94G probably benign Het
Tnpo2 A G 8: 85,055,359 D869G probably benign Het
Traf6 C T 2: 101,696,684 R260* probably null Het
Ttn C T 2: 76,763,949 V20552I possibly damaging Het
Vmn2r102 T A 17: 19,677,867 D381E probably benign Het
Vmn2r92 T C 17: 18,184,939 F782L possibly damaging Het
Zfc3h1 G A 10: 115,408,916 D765N possibly damaging Het
Zfp472 T A 17: 32,977,297 H115Q possibly damaging Het
Zmynd11 T A 13: 9,689,208 N514I probably benign Het
Other mutations in Nos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Nos2 APN 11 78957452 missense probably damaging 0.96
IGL01503:Nos2 APN 11 78945863 splice site probably benign
IGL01789:Nos2 APN 11 78944657 splice site probably benign
IGL02797:Nos2 APN 11 78940344 missense probably damaging 1.00
IGL02968:Nos2 APN 11 78937637 missense probably damaging 1.00
R6762_Nos2_754 UTSW 11 78959748 missense possibly damaging 0.90
R0035:Nos2 UTSW 11 78945727 missense probably damaging 1.00
R0265:Nos2 UTSW 11 78937602 missense probably damaging 0.98
R0441:Nos2 UTSW 11 78928583 missense probably benign 0.10
R0504:Nos2 UTSW 11 78940077 missense probably damaging 1.00
R0570:Nos2 UTSW 11 78935361 missense possibly damaging 0.49
R1356:Nos2 UTSW 11 78952803 missense probably benign 0.00
R1538:Nos2 UTSW 11 78956570 missense probably benign 0.00
R3414:Nos2 UTSW 11 78957588 missense probably benign 0.14
R3418:Nos2 UTSW 11 78959695 missense possibly damaging 0.47
R4279:Nos2 UTSW 11 78929776 missense probably benign 0.01
R4492:Nos2 UTSW 11 78950095 missense probably benign
R4632:Nos2 UTSW 11 78957591 missense possibly damaging 0.95
R4686:Nos2 UTSW 11 78928630 missense possibly damaging 0.65
R5038:Nos2 UTSW 11 78922314 missense probably benign
R5214:Nos2 UTSW 11 78955441 missense probably damaging 1.00
R5377:Nos2 UTSW 11 78957491 missense probably benign 0.00
R5777:Nos2 UTSW 11 78940152 missense probably null 1.00
R5834:Nos2 UTSW 11 78928579 missense probably benign 0.01
R5930:Nos2 UTSW 11 78937915 missense probably damaging 1.00
R6511:Nos2 UTSW 11 78955464 splice site probably null
R6706:Nos2 UTSW 11 78944723 missense possibly damaging 0.60
R6747:Nos2 UTSW 11 78952954 missense probably damaging 0.99
R6762:Nos2 UTSW 11 78959748 missense possibly damaging 0.90
R6817:Nos2 UTSW 11 78945266 missense possibly damaging 0.64
R6868:Nos2 UTSW 11 78957506 missense probably benign 0.02
R6917:Nos2 UTSW 11 78951227 missense possibly damaging 0.50
R7082:Nos2 UTSW 11 78928579 missense probably benign 0.02
R7286:Nos2 UTSW 11 78929854 missense probably damaging 1.00
R7367:Nos2 UTSW 11 78950090 missense possibly damaging 0.77
R7398:Nos2 UTSW 11 78936471 nonsense probably null
R7411:Nos2 UTSW 11 78944855 critical splice donor site probably null
R7469:Nos2 UTSW 11 78952971 missense possibly damaging 0.94
R7736:Nos2 UTSW 11 78922366 nonsense probably null
R8694:Nos2 UTSW 11 78945689 missense possibly damaging 0.93
R8832:Nos2 UTSW 11 78955464 splice site probably null
R8872:Nos2 UTSW 11 78949123 missense probably damaging 0.99
R8952:Nos2 UTSW 11 78945263 missense probably benign 0.00
R9433:Nos2 UTSW 11 78959664 missense probably damaging 1.00
R9580:Nos2 UTSW 11 78937631 missense probably benign 0.01
R9612:Nos2 UTSW 11 78949158 missense probably damaging 1.00
R9727:Nos2 UTSW 11 78952999 missense possibly damaging 0.51
X0063:Nos2 UTSW 11 78922367 missense probably benign 0.01
Z1177:Nos2 UTSW 11 78931672 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGGTTGACTCCACGGAGAAG -3'
(R):5'- GAGTTCACCGATCAGAGTGG -3'

Sequencing Primer
(F):5'- TCATTGTGAGCATACCGGC -3'
(R):5'- TTCACCGATCAGAGTGGAACAG -3'
Posted On 2022-11-14