Incidental Mutation 'R9747:Cacna1i'
ID 732254
Institutional Source Beutler Lab
Gene Symbol Cacna1i
Ensembl Gene ENSMUSG00000022416
Gene Name calcium channel, voltage-dependent, alpha 1I subunit
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9747 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 80171439-80282480 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 80246318 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 571 (E571K)
Ref Sequence ENSEMBL: ENSMUSP00000125063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160424] [ENSMUST00000162155]
AlphaFold E9Q7P2
Predicted Effect probably benign
Transcript: ENSMUST00000160424
AA Change: E571K

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000125063
Gene: ENSMUSG00000022416
AA Change: E571K

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 76 407 1.4e-79 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 597 830 7.4e-58 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1128 1401 7.8e-65 PFAM
Pfam:Ion_trans 1445 1700 9.4e-58 PFAM
Pfam:PKD_channel 1538 1694 1.4e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
low complexity region 1837 1853 N/A INTRINSIC
low complexity region 1922 1933 N/A INTRINSIC
low complexity region 1990 2005 N/A INTRINSIC
low complexity region 2041 2058 N/A INTRINSIC
low complexity region 2087 2097 N/A INTRINSIC
low complexity region 2103 2126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162155
AA Change: E571K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125229
Gene: ENSMUSG00000022416
AA Change: E571K

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 115 395 1.9e-66 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 632 819 2.4e-45 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1165 1389 6.2e-55 PFAM
coiled coil region 1394 1426 N/A INTRINSIC
Pfam:Ion_trans 1480 1688 1.9e-47 PFAM
Pfam:PKD_channel 1538 1694 4.8e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the pore-forming alpha subunit of a voltage gated calcium channel. The encoded protein is a member of a subfamily of calcium channels referred to as is a low voltage-activated, T-type, calcium channel. The channel encoded by this protein is characterized by a slower activation and inactivation compared to other T-type calcium channels. This protein may be involved in calcium signaling in neurons. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,668,711 (GRCm39) S701P probably damaging Het
Acsl1 A G 8: 46,961,397 (GRCm39) K114R probably benign Het
Adam11 A G 11: 102,663,495 (GRCm39) N275D probably damaging Het
Adamts19 G A 18: 59,023,487 (GRCm39) R294H possibly damaging Het
Adamts20 C T 15: 94,180,943 (GRCm39) C1666Y probably damaging Het
Ahnak A T 19: 8,987,541 (GRCm39) I2942L possibly damaging Het
Ank1 A G 8: 23,576,993 (GRCm39) H195R probably damaging Het
Ank2 T C 3: 126,752,667 (GRCm39) T350A probably damaging Het
Asb3 T A 11: 31,008,946 (GRCm39) N243K possibly damaging Het
Atp10b C T 11: 43,088,339 (GRCm39) T315I probably benign Het
Avl9 C T 6: 56,730,825 (GRCm39) S583F probably damaging Het
Bclaf1 A G 10: 20,207,892 (GRCm39) K700E possibly damaging Het
Brd10 C A 19: 29,731,911 (GRCm39) C367F possibly damaging Het
Casp1 T A 9: 5,299,322 (GRCm39) V17E probably damaging Het
Ccdc115 A T 1: 34,478,001 (GRCm39) D76E probably benign Het
Ccdc150 A T 1: 54,299,107 (GRCm39) R28* probably null Het
Cd36 T G 5: 18,019,732 (GRCm39) E123A probably benign Het
Cd5l A C 3: 87,275,104 (GRCm39) Q214H probably benign Het
Cfap46 T A 7: 139,191,907 (GRCm39) H2370L unknown Het
Cftr C A 6: 18,285,636 (GRCm39) T1148K possibly damaging Het
Col15a1 T A 4: 47,312,208 (GRCm39) L1341Q probably damaging Het
Col6a6 T C 9: 105,661,239 (GRCm39) E290G probably benign Het
D6Wsu163e A G 6: 126,938,977 (GRCm39) E404G probably benign Het
Dchs1 A T 7: 105,412,682 (GRCm39) D1239E probably damaging Het
Dennd4b C T 3: 90,177,828 (GRCm39) T430I possibly damaging Het
Dmgdh C T 13: 93,825,154 (GRCm39) P159L probably damaging Het
Dmrt3 G A 19: 25,600,003 (GRCm39) D283N probably damaging Het
Dnttip1 A G 2: 164,607,100 (GRCm39) D247G probably damaging Het
Efhc1 A T 1: 21,048,928 (GRCm39) D447V probably damaging Het
Ehhadh T C 16: 21,585,138 (GRCm39) K248E probably benign Het
Eif4enif1 T C 11: 3,163,267 (GRCm39) L34P probably damaging Het
Fer T C 17: 64,214,376 (GRCm39) M103T probably benign Het
Gabrg1 T C 5: 70,938,029 (GRCm39) M197V probably damaging Het
Galnt5 C A 2: 57,889,477 (GRCm39) T359K probably benign Het
Gm8108 G T 14: 4,110,527 (GRCm38) probably benign Het
Gna12 T C 5: 140,746,602 (GRCm39) N281S probably damaging Het
Golgb1 C T 16: 36,713,769 (GRCm39) T250I probably damaging Het
Gpd1 A G 15: 99,618,004 (GRCm39) K130E probably benign Het
Gys2 A T 6: 142,395,181 (GRCm39) M428K possibly damaging Het
Hey2 A C 10: 30,709,824 (GRCm39) S310A probably benign Het
Ifi47 T C 11: 48,987,367 (GRCm39) V378A possibly damaging Het
Ighv8-12 A G 12: 115,611,640 (GRCm39) S95P probably damaging Het
Igkv1-131 G T 6: 67,743,215 (GRCm39) T56K probably damaging Het
Igsf23 T C 7: 19,675,839 (GRCm39) N127S probably benign Het
Iqgap2 T A 13: 95,821,505 (GRCm39) N546I probably damaging Het
Irf9 A G 14: 55,844,045 (GRCm39) H270R probably benign Het
Itga6 C T 2: 71,656,871 (GRCm39) S375L probably damaging Het
Jak1 T C 4: 101,016,087 (GRCm39) E857G probably benign Het
Kbtbd8 A G 6: 95,098,838 (GRCm39) T116A possibly damaging Het
Kif5a T C 10: 127,074,622 (GRCm39) I570V probably benign Het
Klhdc10 T C 6: 30,439,859 (GRCm39) M154T possibly damaging Het
Krtap6-2 A G 16: 89,216,776 (GRCm39) Y64H unknown Het
Lce1l C T 3: 92,757,828 (GRCm39) C10Y unknown Het
Lrrc72 A G 12: 36,264,371 (GRCm39) Y29H probably damaging Het
Ltbp2 A T 12: 84,915,515 (GRCm39) N181K probably damaging Het
Ly75 A G 2: 60,136,672 (GRCm39) probably null Het
Mpped1 A G 15: 83,684,305 (GRCm39) Y109C probably damaging Het
Mrgpra2a C T 7: 47,076,458 (GRCm39) V267I probably benign Het
Muc4 T A 16: 32,754,698 (GRCm38) V1524E probably benign Het
Nabp2 T A 10: 128,237,610 (GRCm39) R208* probably null Het
Ndst3 A G 3: 123,340,461 (GRCm39) F786L possibly damaging Het
Nos2 C T 11: 78,822,472 (GRCm39) P123S probably damaging Het
Nrcam T A 12: 44,645,192 (GRCm39) V1198E probably damaging Het
Oacyl A G 18: 65,880,962 (GRCm39) Q592R possibly damaging Het
Or10ak9 C T 4: 118,726,217 (GRCm39) P80S probably damaging Het
Or5as1 T A 2: 86,980,898 (GRCm39) T36S probably benign Het
Pcdhgc4 A G 18: 37,951,026 (GRCm39) Y814C probably benign Het
Pcm1 A C 8: 41,757,135 (GRCm39) H1349P probably benign Het
Pcsk6 T A 7: 65,633,470 (GRCm39) D567E probably damaging Het
Pdgfd T C 9: 6,337,310 (GRCm39) V214A probably benign Het
Plekhg3 A T 12: 76,611,367 (GRCm39) N270I probably damaging Het
Rasgrf1 T A 9: 89,877,047 (GRCm39) V804E probably benign Het
Rbl1 G T 2: 157,033,966 (GRCm39) L371I probably damaging Het
Rcl1 T A 19: 29,105,482 (GRCm39) I223N probably damaging Het
Saa4 C T 7: 46,381,077 (GRCm39) G15E probably damaging Het
Selenbp1 T C 3: 94,844,648 (GRCm39) S102P probably damaging Het
Setx G T 2: 29,064,377 (GRCm39) E232* probably null Het
Sik2 A G 9: 50,810,058 (GRCm39) F502L possibly damaging Het
Slamf9 A T 1: 172,305,782 (GRCm39) I272F unknown Het
Slc33a1 A T 3: 63,861,424 (GRCm39) D259E probably benign Het
Slc41a3 A G 6: 90,621,138 (GRCm39) I393V probably benign Het
Slk A G 19: 47,608,346 (GRCm39) D433G possibly damaging Het
Spata13 C T 14: 60,929,240 (GRCm39) P266L probably benign Het
Speer4c1 T A 5: 15,916,652 (GRCm39) Q105L probably benign Het
Srgap1 T A 10: 121,761,771 (GRCm39) I126F probably damaging Het
Srgap1 A G 10: 121,628,579 (GRCm39) S818P probably benign Het
Tbpl2 A T 2: 23,981,104 (GRCm39) C232* probably null Het
Tctn3 T G 19: 40,599,743 (GRCm39) N153T possibly damaging Het
Tdrd1 T A 19: 56,847,101 (GRCm39) V914E probably benign Het
Tmem200b A G 4: 131,649,359 (GRCm39) H93R possibly damaging Het
Tmem33 T G 5: 67,425,922 (GRCm39) N155K possibly damaging Het
Tmprss15 T C 16: 78,884,400 (GRCm39) D94G probably benign Het
Tnpo2 A G 8: 85,781,988 (GRCm39) D869G probably benign Het
Traf6 C T 2: 101,527,029 (GRCm39) R260* probably null Het
Ttn C T 2: 76,594,293 (GRCm39) V20552I possibly damaging Het
Vmn2r102 T A 17: 19,898,129 (GRCm39) D381E probably benign Het
Vmn2r92 T C 17: 18,405,201 (GRCm39) F782L possibly damaging Het
Zfc3h1 G A 10: 115,244,821 (GRCm39) D765N possibly damaging Het
Zfp472 T A 17: 33,196,271 (GRCm39) H115Q possibly damaging Het
Zmynd11 T A 13: 9,739,244 (GRCm39) N514I probably benign Het
Other mutations in Cacna1i
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Cacna1i APN 15 80,266,220 (GRCm39) missense probably damaging 1.00
IGL00976:Cacna1i APN 15 80,239,846 (GRCm39) missense probably benign
IGL01338:Cacna1i APN 15 80,232,581 (GRCm39) missense probably damaging 0.99
IGL01589:Cacna1i APN 15 80,271,960 (GRCm39) splice site probably benign
IGL01669:Cacna1i APN 15 80,275,958 (GRCm39) missense probably benign
IGL01807:Cacna1i APN 15 80,258,348 (GRCm39) missense probably damaging 1.00
IGL01911:Cacna1i APN 15 80,275,933 (GRCm39) missense probably benign 0.09
IGL01973:Cacna1i APN 15 80,266,234 (GRCm39) missense probably damaging 1.00
IGL02205:Cacna1i APN 15 80,257,152 (GRCm39) missense probably benign 0.06
IGL02519:Cacna1i APN 15 80,246,075 (GRCm39) nonsense probably null
IGL02648:Cacna1i APN 15 80,182,839 (GRCm39) missense probably damaging 0.96
IGL03033:Cacna1i APN 15 80,246,440 (GRCm39) missense probably damaging 0.98
IGL03214:Cacna1i APN 15 80,239,917 (GRCm39) missense probably benign 0.30
R0067:Cacna1i UTSW 15 80,265,373 (GRCm39) missense probably damaging 1.00
R0067:Cacna1i UTSW 15 80,265,373 (GRCm39) missense probably damaging 1.00
R0295:Cacna1i UTSW 15 80,240,412 (GRCm39) missense probably damaging 1.00
R0345:Cacna1i UTSW 15 80,256,663 (GRCm39) missense probably damaging 0.98
R0415:Cacna1i UTSW 15 80,253,031 (GRCm39) splice site probably benign
R0637:Cacna1i UTSW 15 80,256,855 (GRCm39) missense probably damaging 0.99
R0638:Cacna1i UTSW 15 80,265,281 (GRCm39) missense possibly damaging 0.94
R0840:Cacna1i UTSW 15 80,243,150 (GRCm39) missense possibly damaging 0.85
R1463:Cacna1i UTSW 15 80,263,255 (GRCm39) missense possibly damaging 0.96
R1528:Cacna1i UTSW 15 80,275,975 (GRCm39) splice site probably null
R1563:Cacna1i UTSW 15 80,274,056 (GRCm39) splice site probably benign
R1563:Cacna1i UTSW 15 80,205,389 (GRCm39) missense probably damaging 0.97
R1573:Cacna1i UTSW 15 80,277,869 (GRCm39) splice site probably null
R1654:Cacna1i UTSW 15 80,273,411 (GRCm39) missense probably damaging 1.00
R1754:Cacna1i UTSW 15 80,255,730 (GRCm39) missense probably damaging 0.99
R1794:Cacna1i UTSW 15 80,273,323 (GRCm39) missense probably damaging 1.00
R1824:Cacna1i UTSW 15 80,260,990 (GRCm39) missense possibly damaging 0.64
R1863:Cacna1i UTSW 15 80,243,132 (GRCm39) missense probably damaging 1.00
R1885:Cacna1i UTSW 15 80,243,145 (GRCm39) missense probably damaging 0.99
R1886:Cacna1i UTSW 15 80,243,145 (GRCm39) missense probably damaging 0.99
R1899:Cacna1i UTSW 15 80,275,843 (GRCm39) missense possibly damaging 0.91
R1907:Cacna1i UTSW 15 80,259,465 (GRCm39) missense probably damaging 1.00
R1943:Cacna1i UTSW 15 80,279,245 (GRCm39) missense probably benign
R2162:Cacna1i UTSW 15 80,240,388 (GRCm39) missense probably damaging 1.00
R2888:Cacna1i UTSW 15 80,258,968 (GRCm39) missense probably damaging 1.00
R3701:Cacna1i UTSW 15 80,265,272 (GRCm39) splice site probably benign
R3702:Cacna1i UTSW 15 80,265,272 (GRCm39) splice site probably benign
R3832:Cacna1i UTSW 15 80,240,388 (GRCm39) missense probably damaging 1.00
R4852:Cacna1i UTSW 15 80,272,680 (GRCm39) missense probably damaging 0.99
R4857:Cacna1i UTSW 15 80,253,863 (GRCm39) missense probably damaging 1.00
R4950:Cacna1i UTSW 15 80,252,872 (GRCm39) missense probably damaging 1.00
R4980:Cacna1i UTSW 15 80,232,650 (GRCm39) missense probably damaging 0.97
R5217:Cacna1i UTSW 15 80,275,041 (GRCm39) missense possibly damaging 0.94
R5437:Cacna1i UTSW 15 80,255,730 (GRCm39) missense probably damaging 1.00
R5519:Cacna1i UTSW 15 80,255,700 (GRCm39) missense probably damaging 1.00
R5642:Cacna1i UTSW 15 80,279,279 (GRCm39) missense possibly damaging 0.47
R6217:Cacna1i UTSW 15 80,273,333 (GRCm39) missense probably damaging 1.00
R6225:Cacna1i UTSW 15 80,205,427 (GRCm39) missense probably damaging 1.00
R6251:Cacna1i UTSW 15 80,220,883 (GRCm39) missense probably damaging 1.00
R6463:Cacna1i UTSW 15 80,239,959 (GRCm39) missense probably damaging 0.97
R6490:Cacna1i UTSW 15 80,262,448 (GRCm39) missense probably damaging 1.00
R6613:Cacna1i UTSW 15 80,205,460 (GRCm39) missense probably damaging 1.00
R6884:Cacna1i UTSW 15 80,259,010 (GRCm39) missense probably damaging 1.00
R6904:Cacna1i UTSW 15 80,259,002 (GRCm39) missense probably damaging 1.00
R7017:Cacna1i UTSW 15 80,264,671 (GRCm39) missense probably damaging 1.00
R7155:Cacna1i UTSW 15 80,279,439 (GRCm39) missense probably benign 0.04
R7274:Cacna1i UTSW 15 80,261,023 (GRCm39) missense possibly damaging 0.95
R7323:Cacna1i UTSW 15 80,275,854 (GRCm39) missense possibly damaging 0.86
R7335:Cacna1i UTSW 15 80,259,776 (GRCm39) missense probably damaging 1.00
R7571:Cacna1i UTSW 15 80,259,537 (GRCm39) missense probably damaging 1.00
R7768:Cacna1i UTSW 15 80,265,389 (GRCm39) missense probably damaging 1.00
R7820:Cacna1i UTSW 15 80,256,573 (GRCm39) missense probably benign 0.00
R7987:Cacna1i UTSW 15 80,204,553 (GRCm39) splice site probably null
R8150:Cacna1i UTSW 15 80,259,540 (GRCm39) missense probably damaging 1.00
R8206:Cacna1i UTSW 15 80,274,016 (GRCm39) splice site probably null
R8270:Cacna1i UTSW 15 80,257,835 (GRCm39) missense probably damaging 0.99
R8382:Cacna1i UTSW 15 80,261,017 (GRCm39) missense probably damaging 0.99
R8501:Cacna1i UTSW 15 80,266,247 (GRCm39) critical splice donor site probably null
R8518:Cacna1i UTSW 15 80,243,095 (GRCm39) nonsense probably null
R8552:Cacna1i UTSW 15 80,204,598 (GRCm39) missense possibly damaging 0.69
R8679:Cacna1i UTSW 15 80,260,011 (GRCm39) intron probably benign
R8696:Cacna1i UTSW 15 80,266,175 (GRCm39) missense probably damaging 0.98
R8887:Cacna1i UTSW 15 80,258,894 (GRCm39) missense possibly damaging 0.91
R9274:Cacna1i UTSW 15 80,254,354 (GRCm39) missense probably damaging 1.00
R9379:Cacna1i UTSW 15 80,259,495 (GRCm39) missense probably damaging 1.00
R9508:Cacna1i UTSW 15 80,279,372 (GRCm39) missense probably benign 0.06
R9518:Cacna1i UTSW 15 80,271,978 (GRCm39) missense probably damaging 1.00
R9674:Cacna1i UTSW 15 80,264,629 (GRCm39) missense probably damaging 1.00
R9769:Cacna1i UTSW 15 80,253,793 (GRCm39) missense probably damaging 1.00
X0022:Cacna1i UTSW 15 80,246,163 (GRCm39) missense probably damaging 0.99
X0024:Cacna1i UTSW 15 80,246,340 (GRCm39) missense probably benign 0.03
X0058:Cacna1i UTSW 15 80,263,303 (GRCm39) missense probably damaging 1.00
Z1177:Cacna1i UTSW 15 80,273,584 (GRCm39) missense possibly damaging 0.94
Z1177:Cacna1i UTSW 15 80,265,380 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TTTTCAGAGCTGTGCCCACG -3'
(R):5'- AAACCCTGTATCCCCACTTG -3'

Sequencing Primer
(F):5'- ACTGGTGCAGCCCATCTCTG -3'
(R):5'- ACTTGCCTGTTCATGGTGC -3'
Posted On 2022-11-14