Incidental Mutation 'R9747:Golgb1'
ID 732261
Institutional Source Beutler Lab
Gene Symbol Golgb1
Ensembl Gene ENSMUSG00000034243
Gene Name golgin B1
Synonyms C130074L01Rik, Gm6840, F730017E11Rik, Giantin, 6330407A06Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.918) question?
Stock # R9747 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 36695502-36753447 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 36713769 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 250 (T250I)
Ref Sequence ENSEMBL: ENSMUSP00000045239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039855] [ENSMUST00000114812] [ENSMUST00000134616]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000039855
AA Change: T250I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045239
Gene: ENSMUSG00000034243
AA Change: T250I

DomainStartEndE-ValueType
internal_repeat_2 24 61 7.47e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
coiled coil region 130 219 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
internal_repeat_3 519 558 7.47e-6 PROSPERO
coiled coil region 563 594 N/A INTRINSIC
internal_repeat_4 627 661 3.38e-5 PROSPERO
coiled coil region 679 1121 N/A INTRINSIC
coiled coil region 1153 1240 N/A INTRINSIC
internal_repeat_4 1253 1288 3.38e-5 PROSPERO
low complexity region 1300 1314 N/A INTRINSIC
internal_repeat_1 1321 1352 3.51e-6 PROSPERO
low complexity region 1357 1369 N/A INTRINSIC
coiled coil region 1402 1755 N/A INTRINSIC
internal_repeat_2 1760 1798 7.47e-6 PROSPERO
internal_repeat_3 1761 1804 7.47e-6 PROSPERO
coiled coil region 1818 2034 N/A INTRINSIC
low complexity region 2291 2306 N/A INTRINSIC
internal_repeat_1 2351 2382 3.51e-6 PROSPERO
low complexity region 2400 2418 N/A INTRINSIC
low complexity region 2538 2549 N/A INTRINSIC
coiled coil region 2775 2827 N/A INTRINSIC
coiled coil region 2854 2943 N/A INTRINSIC
low complexity region 2964 2976 N/A INTRINSIC
coiled coil region 3007 3057 N/A INTRINSIC
coiled coil region 3117 3163 N/A INTRINSIC
transmembrane domain 3215 3237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114812
SMART Domains Protein: ENSMUSP00000110460
Gene: ENSMUSG00000034243

DomainStartEndE-ValueType
internal_repeat_2 24 61 6.71e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
low complexity region 143 154 N/A INTRINSIC
low complexity region 200 219 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
internal_repeat_3 478 517 6.71e-6 PROSPERO
coiled coil region 522 553 N/A INTRINSIC
internal_repeat_4 586 620 3.05e-5 PROSPERO
coiled coil region 638 1080 N/A INTRINSIC
coiled coil region 1112 1199 N/A INTRINSIC
internal_repeat_4 1212 1247 3.05e-5 PROSPERO
low complexity region 1259 1273 N/A INTRINSIC
internal_repeat_1 1280 1311 3.14e-6 PROSPERO
low complexity region 1316 1328 N/A INTRINSIC
coiled coil region 1361 1714 N/A INTRINSIC
internal_repeat_2 1719 1757 6.71e-6 PROSPERO
internal_repeat_3 1720 1763 6.71e-6 PROSPERO
coiled coil region 1777 1993 N/A INTRINSIC
low complexity region 2250 2265 N/A INTRINSIC
internal_repeat_1 2310 2341 3.14e-6 PROSPERO
low complexity region 2359 2377 N/A INTRINSIC
low complexity region 2497 2508 N/A INTRINSIC
coiled coil region 2734 2786 N/A INTRINSIC
coiled coil region 2813 2902 N/A INTRINSIC
low complexity region 2923 2935 N/A INTRINSIC
coiled coil region 2966 3016 N/A INTRINSIC
coiled coil region 3076 3122 N/A INTRINSIC
transmembrane domain 3174 3196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134616
SMART Domains Protein: ENSMUSP00000116503
Gene: ENSMUSG00000034243

DomainStartEndE-ValueType
coiled coil region 42 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout affects glycosylation of glycoproteins in the extra-cellular matrix of the palatal shelves, resulting in their failure to elevate and fuse, leading to cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,668,711 (GRCm39) S701P probably damaging Het
Acsl1 A G 8: 46,961,397 (GRCm39) K114R probably benign Het
Adam11 A G 11: 102,663,495 (GRCm39) N275D probably damaging Het
Adamts19 G A 18: 59,023,487 (GRCm39) R294H possibly damaging Het
Adamts20 C T 15: 94,180,943 (GRCm39) C1666Y probably damaging Het
Ahnak A T 19: 8,987,541 (GRCm39) I2942L possibly damaging Het
Ank1 A G 8: 23,576,993 (GRCm39) H195R probably damaging Het
Ank2 T C 3: 126,752,667 (GRCm39) T350A probably damaging Het
Asb3 T A 11: 31,008,946 (GRCm39) N243K possibly damaging Het
Atp10b C T 11: 43,088,339 (GRCm39) T315I probably benign Het
Avl9 C T 6: 56,730,825 (GRCm39) S583F probably damaging Het
Bclaf1 A G 10: 20,207,892 (GRCm39) K700E possibly damaging Het
Brd10 C A 19: 29,731,911 (GRCm39) C367F possibly damaging Het
Cacna1i G A 15: 80,246,318 (GRCm39) E571K probably benign Het
Casp1 T A 9: 5,299,322 (GRCm39) V17E probably damaging Het
Ccdc115 A T 1: 34,478,001 (GRCm39) D76E probably benign Het
Ccdc150 A T 1: 54,299,107 (GRCm39) R28* probably null Het
Cd36 T G 5: 18,019,732 (GRCm39) E123A probably benign Het
Cd5l A C 3: 87,275,104 (GRCm39) Q214H probably benign Het
Cfap46 T A 7: 139,191,907 (GRCm39) H2370L unknown Het
Cftr C A 6: 18,285,636 (GRCm39) T1148K possibly damaging Het
Col15a1 T A 4: 47,312,208 (GRCm39) L1341Q probably damaging Het
Col6a6 T C 9: 105,661,239 (GRCm39) E290G probably benign Het
D6Wsu163e A G 6: 126,938,977 (GRCm39) E404G probably benign Het
Dchs1 A T 7: 105,412,682 (GRCm39) D1239E probably damaging Het
Dennd4b C T 3: 90,177,828 (GRCm39) T430I possibly damaging Het
Dmgdh C T 13: 93,825,154 (GRCm39) P159L probably damaging Het
Dmrt3 G A 19: 25,600,003 (GRCm39) D283N probably damaging Het
Dnttip1 A G 2: 164,607,100 (GRCm39) D247G probably damaging Het
Efhc1 A T 1: 21,048,928 (GRCm39) D447V probably damaging Het
Ehhadh T C 16: 21,585,138 (GRCm39) K248E probably benign Het
Eif4enif1 T C 11: 3,163,267 (GRCm39) L34P probably damaging Het
Fer T C 17: 64,214,376 (GRCm39) M103T probably benign Het
Gabrg1 T C 5: 70,938,029 (GRCm39) M197V probably damaging Het
Galnt5 C A 2: 57,889,477 (GRCm39) T359K probably benign Het
Gm8108 G T 14: 4,110,527 (GRCm38) probably benign Het
Gna12 T C 5: 140,746,602 (GRCm39) N281S probably damaging Het
Gpd1 A G 15: 99,618,004 (GRCm39) K130E probably benign Het
Gys2 A T 6: 142,395,181 (GRCm39) M428K possibly damaging Het
Hey2 A C 10: 30,709,824 (GRCm39) S310A probably benign Het
Ifi47 T C 11: 48,987,367 (GRCm39) V378A possibly damaging Het
Ighv8-12 A G 12: 115,611,640 (GRCm39) S95P probably damaging Het
Igkv1-131 G T 6: 67,743,215 (GRCm39) T56K probably damaging Het
Igsf23 T C 7: 19,675,839 (GRCm39) N127S probably benign Het
Iqgap2 T A 13: 95,821,505 (GRCm39) N546I probably damaging Het
Irf9 A G 14: 55,844,045 (GRCm39) H270R probably benign Het
Itga6 C T 2: 71,656,871 (GRCm39) S375L probably damaging Het
Jak1 T C 4: 101,016,087 (GRCm39) E857G probably benign Het
Kbtbd8 A G 6: 95,098,838 (GRCm39) T116A possibly damaging Het
Kif5a T C 10: 127,074,622 (GRCm39) I570V probably benign Het
Klhdc10 T C 6: 30,439,859 (GRCm39) M154T possibly damaging Het
Krtap6-2 A G 16: 89,216,776 (GRCm39) Y64H unknown Het
Lce1l C T 3: 92,757,828 (GRCm39) C10Y unknown Het
Lrrc72 A G 12: 36,264,371 (GRCm39) Y29H probably damaging Het
Ltbp2 A T 12: 84,915,515 (GRCm39) N181K probably damaging Het
Ly75 A G 2: 60,136,672 (GRCm39) probably null Het
Mpped1 A G 15: 83,684,305 (GRCm39) Y109C probably damaging Het
Mrgpra2a C T 7: 47,076,458 (GRCm39) V267I probably benign Het
Muc4 T A 16: 32,754,698 (GRCm38) V1524E probably benign Het
Nabp2 T A 10: 128,237,610 (GRCm39) R208* probably null Het
Ndst3 A G 3: 123,340,461 (GRCm39) F786L possibly damaging Het
Nos2 C T 11: 78,822,472 (GRCm39) P123S probably damaging Het
Nrcam T A 12: 44,645,192 (GRCm39) V1198E probably damaging Het
Oacyl A G 18: 65,880,962 (GRCm39) Q592R possibly damaging Het
Or10ak9 C T 4: 118,726,217 (GRCm39) P80S probably damaging Het
Or5as1 T A 2: 86,980,898 (GRCm39) T36S probably benign Het
Pcdhgc4 A G 18: 37,951,026 (GRCm39) Y814C probably benign Het
Pcm1 A C 8: 41,757,135 (GRCm39) H1349P probably benign Het
Pcsk6 T A 7: 65,633,470 (GRCm39) D567E probably damaging Het
Pdgfd T C 9: 6,337,310 (GRCm39) V214A probably benign Het
Plekhg3 A T 12: 76,611,367 (GRCm39) N270I probably damaging Het
Rasgrf1 T A 9: 89,877,047 (GRCm39) V804E probably benign Het
Rbl1 G T 2: 157,033,966 (GRCm39) L371I probably damaging Het
Rcl1 T A 19: 29,105,482 (GRCm39) I223N probably damaging Het
Saa4 C T 7: 46,381,077 (GRCm39) G15E probably damaging Het
Selenbp1 T C 3: 94,844,648 (GRCm39) S102P probably damaging Het
Setx G T 2: 29,064,377 (GRCm39) E232* probably null Het
Sik2 A G 9: 50,810,058 (GRCm39) F502L possibly damaging Het
Slamf9 A T 1: 172,305,782 (GRCm39) I272F unknown Het
Slc33a1 A T 3: 63,861,424 (GRCm39) D259E probably benign Het
Slc41a3 A G 6: 90,621,138 (GRCm39) I393V probably benign Het
Slk A G 19: 47,608,346 (GRCm39) D433G possibly damaging Het
Spata13 C T 14: 60,929,240 (GRCm39) P266L probably benign Het
Speer4c1 T A 5: 15,916,652 (GRCm39) Q105L probably benign Het
Srgap1 T A 10: 121,761,771 (GRCm39) I126F probably damaging Het
Srgap1 A G 10: 121,628,579 (GRCm39) S818P probably benign Het
Tbpl2 A T 2: 23,981,104 (GRCm39) C232* probably null Het
Tctn3 T G 19: 40,599,743 (GRCm39) N153T possibly damaging Het
Tdrd1 T A 19: 56,847,101 (GRCm39) V914E probably benign Het
Tmem200b A G 4: 131,649,359 (GRCm39) H93R possibly damaging Het
Tmem33 T G 5: 67,425,922 (GRCm39) N155K possibly damaging Het
Tmprss15 T C 16: 78,884,400 (GRCm39) D94G probably benign Het
Tnpo2 A G 8: 85,781,988 (GRCm39) D869G probably benign Het
Traf6 C T 2: 101,527,029 (GRCm39) R260* probably null Het
Ttn C T 2: 76,594,293 (GRCm39) V20552I possibly damaging Het
Vmn2r102 T A 17: 19,898,129 (GRCm39) D381E probably benign Het
Vmn2r92 T C 17: 18,405,201 (GRCm39) F782L possibly damaging Het
Zfc3h1 G A 10: 115,244,821 (GRCm39) D765N possibly damaging Het
Zfp472 T A 17: 33,196,271 (GRCm39) H115Q possibly damaging Het
Zmynd11 T A 13: 9,739,244 (GRCm39) N514I probably benign Het
Other mutations in Golgb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Golgb1 APN 16 36,751,926 (GRCm39) missense probably damaging 1.00
IGL01717:Golgb1 APN 16 36,735,864 (GRCm39) nonsense probably null
IGL01965:Golgb1 APN 16 36,738,282 (GRCm39) missense probably damaging 1.00
IGL02128:Golgb1 APN 16 36,736,666 (GRCm39) missense probably damaging 1.00
IGL02268:Golgb1 APN 16 36,733,490 (GRCm39) missense probably benign 0.25
IGL02383:Golgb1 APN 16 36,706,562 (GRCm39) missense probably benign 0.01
IGL02444:Golgb1 APN 16 36,728,178 (GRCm39) splice site probably benign
IGL02635:Golgb1 APN 16 36,735,375 (GRCm39) missense probably benign 0.00
IGL02655:Golgb1 APN 16 36,738,442 (GRCm39) missense probably damaging 0.98
IGL02887:Golgb1 APN 16 36,746,211 (GRCm39) missense probably damaging 0.99
IGL02937:Golgb1 APN 16 36,736,572 (GRCm39) missense probably damaging 1.00
IGL02973:Golgb1 APN 16 36,732,442 (GRCm39) missense possibly damaging 0.92
IGL02982:Golgb1 APN 16 36,746,172 (GRCm39) missense probably damaging 0.98
IGL03065:Golgb1 APN 16 36,733,228 (GRCm39) missense probably benign 0.11
IGL03109:Golgb1 APN 16 36,735,973 (GRCm39) missense possibly damaging 0.93
IGL03323:Golgb1 APN 16 36,733,815 (GRCm39) nonsense probably null
I2288:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
I2289:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
R0071:Golgb1 UTSW 16 36,735,865 (GRCm39) missense probably benign 0.00
R0071:Golgb1 UTSW 16 36,735,865 (GRCm39) missense probably benign 0.00
R0080:Golgb1 UTSW 16 36,718,973 (GRCm39) missense probably damaging 1.00
R0102:Golgb1 UTSW 16 36,695,830 (GRCm39) intron probably benign
R0242:Golgb1 UTSW 16 36,695,992 (GRCm39) nonsense probably null
R0242:Golgb1 UTSW 16 36,695,992 (GRCm39) nonsense probably null
R0276:Golgb1 UTSW 16 36,734,238 (GRCm39) missense probably damaging 1.00
R0394:Golgb1 UTSW 16 36,695,941 (GRCm39) intron probably benign
R0469:Golgb1 UTSW 16 36,751,997 (GRCm39) missense probably benign 0.41
R0522:Golgb1 UTSW 16 36,735,567 (GRCm39) frame shift probably null
R0575:Golgb1 UTSW 16 36,739,171 (GRCm39) missense probably benign
R0600:Golgb1 UTSW 16 36,736,633 (GRCm39) missense probably damaging 1.00
R0608:Golgb1 UTSW 16 36,736,692 (GRCm39) nonsense probably null
R0711:Golgb1 UTSW 16 36,739,152 (GRCm39) missense probably damaging 1.00
R0785:Golgb1 UTSW 16 36,719,152 (GRCm39) missense possibly damaging 0.95
R0893:Golgb1 UTSW 16 36,732,639 (GRCm39) missense possibly damaging 0.64
R1163:Golgb1 UTSW 16 36,736,488 (GRCm39) missense possibly damaging 0.50
R1208:Golgb1 UTSW 16 36,735,567 (GRCm39) frame shift probably null
R1315:Golgb1 UTSW 16 36,735,262 (GRCm39) missense probably benign 0.40
R1429:Golgb1 UTSW 16 36,720,925 (GRCm39) missense possibly damaging 0.93
R1505:Golgb1 UTSW 16 36,740,005 (GRCm39) missense possibly damaging 0.79
R1537:Golgb1 UTSW 16 36,719,150 (GRCm39) missense possibly damaging 0.89
R1610:Golgb1 UTSW 16 36,746,463 (GRCm39) missense probably benign 0.25
R1659:Golgb1 UTSW 16 36,707,979 (GRCm39) missense probably benign 0.01
R1769:Golgb1 UTSW 16 36,736,363 (GRCm39) missense probably damaging 1.00
R2105:Golgb1 UTSW 16 36,735,026 (GRCm39) missense probably benign
R2212:Golgb1 UTSW 16 36,707,709 (GRCm39) missense probably damaging 1.00
R2261:Golgb1 UTSW 16 36,713,722 (GRCm39) missense probably damaging 1.00
R2352:Golgb1 UTSW 16 36,718,921 (GRCm39) missense probably damaging 0.99
R2357:Golgb1 UTSW 16 36,732,370 (GRCm39) missense probably damaging 1.00
R2400:Golgb1 UTSW 16 36,738,828 (GRCm39) missense possibly damaging 0.62
R2513:Golgb1 UTSW 16 36,735,513 (GRCm39) missense possibly damaging 0.73
R3103:Golgb1 UTSW 16 36,715,211 (GRCm39) missense probably damaging 1.00
R3413:Golgb1 UTSW 16 36,707,709 (GRCm39) missense probably damaging 1.00
R3748:Golgb1 UTSW 16 36,739,274 (GRCm39) missense probably benign 0.00
R3847:Golgb1 UTSW 16 36,719,095 (GRCm39) missense probably benign 0.00
R3850:Golgb1 UTSW 16 36,719,095 (GRCm39) missense probably benign 0.00
R3936:Golgb1 UTSW 16 36,734,418 (GRCm39) nonsense probably null
R3975:Golgb1 UTSW 16 36,738,933 (GRCm39) missense probably damaging 0.99
R4025:Golgb1 UTSW 16 36,735,706 (GRCm39) missense probably benign 0.00
R4369:Golgb1 UTSW 16 36,737,269 (GRCm39) missense probably damaging 1.00
R4518:Golgb1 UTSW 16 36,749,625 (GRCm39) missense probably damaging 0.98
R4600:Golgb1 UTSW 16 36,738,987 (GRCm39) missense probably damaging 1.00
R4610:Golgb1 UTSW 16 36,738,987 (GRCm39) missense probably damaging 1.00
R4660:Golgb1 UTSW 16 36,707,980 (GRCm39) missense probably damaging 0.99
R4811:Golgb1 UTSW 16 36,711,781 (GRCm39) missense probably damaging 1.00
R4815:Golgb1 UTSW 16 36,733,477 (GRCm39) missense possibly damaging 0.79
R4835:Golgb1 UTSW 16 36,711,769 (GRCm39) missense possibly damaging 0.86
R4904:Golgb1 UTSW 16 36,713,748 (GRCm39) missense probably damaging 1.00
R4916:Golgb1 UTSW 16 36,736,480 (GRCm39) missense probably benign 0.05
R5121:Golgb1 UTSW 16 36,739,620 (GRCm39) missense probably damaging 0.99
R5133:Golgb1 UTSW 16 36,711,819 (GRCm39) missense possibly damaging 0.75
R5143:Golgb1 UTSW 16 36,719,051 (GRCm39) missense probably benign 0.09
R5185:Golgb1 UTSW 16 36,695,503 (GRCm39) unclassified probably benign
R5188:Golgb1 UTSW 16 36,738,827 (GRCm39) missense probably benign 0.13
R5260:Golgb1 UTSW 16 36,733,503 (GRCm39) missense probably benign 0.00
R5297:Golgb1 UTSW 16 36,695,978 (GRCm39) intron probably benign
R5386:Golgb1 UTSW 16 36,732,677 (GRCm39) nonsense probably null
R5438:Golgb1 UTSW 16 36,720,870 (GRCm39) missense probably benign 0.15
R5439:Golgb1 UTSW 16 36,720,870 (GRCm39) missense probably benign 0.15
R5494:Golgb1 UTSW 16 36,749,045 (GRCm39) missense possibly damaging 0.67
R5592:Golgb1 UTSW 16 36,746,125 (GRCm39) missense probably benign 0.02
R5740:Golgb1 UTSW 16 36,739,362 (GRCm39) missense probably damaging 0.99
R5862:Golgb1 UTSW 16 36,746,453 (GRCm39) splice site silent
R5928:Golgb1 UTSW 16 36,732,349 (GRCm39) missense probably damaging 1.00
R6009:Golgb1 UTSW 16 36,735,321 (GRCm39) missense probably damaging 1.00
R6062:Golgb1 UTSW 16 36,735,033 (GRCm39) missense possibly damaging 0.89
R6102:Golgb1 UTSW 16 36,733,227 (GRCm39) missense probably damaging 1.00
R6198:Golgb1 UTSW 16 36,713,757 (GRCm39) missense probably damaging 1.00
R6253:Golgb1 UTSW 16 36,735,984 (GRCm39) missense possibly damaging 0.77
R6254:Golgb1 UTSW 16 36,734,340 (GRCm39) missense probably damaging 0.99
R6321:Golgb1 UTSW 16 36,738,559 (GRCm39) nonsense probably null
R6700:Golgb1 UTSW 16 36,695,946 (GRCm39) intron probably benign
R6870:Golgb1 UTSW 16 36,738,565 (GRCm39) missense probably damaging 1.00
R6882:Golgb1 UTSW 16 36,734,352 (GRCm39) missense probably benign
R6944:Golgb1 UTSW 16 36,732,475 (GRCm39) missense probably benign
R7108:Golgb1 UTSW 16 36,734,083 (GRCm39) missense probably benign 0.01
R7124:Golgb1 UTSW 16 36,734,035 (GRCm39) missense probably benign 0.01
R7125:Golgb1 UTSW 16 36,738,325 (GRCm39) missense possibly damaging 0.85
R7187:Golgb1 UTSW 16 36,736,512 (GRCm39) missense probably benign 0.43
R7205:Golgb1 UTSW 16 36,695,663 (GRCm39) missense unknown
R7206:Golgb1 UTSW 16 36,734,111 (GRCm39) missense probably benign 0.41
R7233:Golgb1 UTSW 16 36,735,120 (GRCm39) missense possibly damaging 0.91
R7320:Golgb1 UTSW 16 36,736,313 (GRCm39) nonsense probably null
R7367:Golgb1 UTSW 16 36,718,908 (GRCm39) missense probably benign 0.00
R7408:Golgb1 UTSW 16 36,718,909 (GRCm39) missense probably damaging 0.98
R7419:Golgb1 UTSW 16 36,733,281 (GRCm39) missense possibly damaging 0.95
R7556:Golgb1 UTSW 16 36,736,155 (GRCm39) missense probably benign 0.03
R7599:Golgb1 UTSW 16 36,695,758 (GRCm39) missense unknown
R7673:Golgb1 UTSW 16 36,734,031 (GRCm39) missense probably benign 0.05
R7789:Golgb1 UTSW 16 36,695,761 (GRCm39) missense unknown
R7792:Golgb1 UTSW 16 36,739,092 (GRCm39) missense probably benign 0.43
R7830:Golgb1 UTSW 16 36,719,083 (GRCm39) missense possibly damaging 0.93
R7847:Golgb1 UTSW 16 36,752,282 (GRCm39) missense probably damaging 1.00
R7905:Golgb1 UTSW 16 36,734,047 (GRCm39) missense probably benign
R7944:Golgb1 UTSW 16 36,734,466 (GRCm39) missense probably benign 0.02
R7945:Golgb1 UTSW 16 36,734,466 (GRCm39) missense probably benign 0.02
R7950:Golgb1 UTSW 16 36,735,786 (GRCm39) missense probably benign 0.13
R8040:Golgb1 UTSW 16 36,733,841 (GRCm39) missense possibly damaging 0.85
R8077:Golgb1 UTSW 16 36,738,995 (GRCm39) missense probably damaging 0.99
R8181:Golgb1 UTSW 16 36,737,192 (GRCm39) missense probably damaging 1.00
R8370:Golgb1 UTSW 16 36,732,679 (GRCm39) missense probably benign 0.00
R8684:Golgb1 UTSW 16 36,734,764 (GRCm39) missense possibly damaging 0.92
R8725:Golgb1 UTSW 16 36,739,563 (GRCm39) missense probably damaging 1.00
R8727:Golgb1 UTSW 16 36,739,563 (GRCm39) missense probably damaging 1.00
R8738:Golgb1 UTSW 16 36,736,675 (GRCm39) missense probably damaging 1.00
R8785:Golgb1 UTSW 16 36,740,106 (GRCm39) missense probably damaging 0.99
R8824:Golgb1 UTSW 16 36,736,051 (GRCm39) missense probably benign
R8825:Golgb1 UTSW 16 36,739,809 (GRCm39) missense probably benign 0.00
R8940:Golgb1 UTSW 16 36,736,759 (GRCm39) missense probably damaging 1.00
R8962:Golgb1 UTSW 16 36,733,978 (GRCm39) missense probably damaging 1.00
R9245:Golgb1 UTSW 16 36,739,181 (GRCm39) nonsense probably null
R9365:Golgb1 UTSW 16 36,736,124 (GRCm39) missense probably damaging 1.00
R9612:Golgb1 UTSW 16 36,739,967 (GRCm39) missense probably benign 0.41
R9620:Golgb1 UTSW 16 36,739,811 (GRCm39) missense probably benign
R9691:Golgb1 UTSW 16 36,718,996 (GRCm39) missense probably damaging 1.00
V1662:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
X0067:Golgb1 UTSW 16 36,734,665 (GRCm39) nonsense probably null
Z1088:Golgb1 UTSW 16 36,740,104 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGAGTAGGCTGTAAGAGTC -3'
(R):5'- TAAAGTGCCAAGCTCCGACC -3'

Sequencing Primer
(F):5'- AAGAGTCGTCTGTGAAATGCTC -3'
(R):5'- GAGAATGTAAGCTCAGGACCCC -3'
Posted On 2022-11-14