Incidental Mutation 'R9748:Adamts12'
ID 732353
Institutional Source Beutler Lab
Gene Symbol Adamts12
Ensembl Gene ENSMUSG00000047497
Gene Name a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12
Synonyms AI605170; ADAMTS-12
MMRRC Submission
Accession Numbers

Genbank: NM_175501.2; MGI:2146046
Essential gene? Probably non essential (E-score: 0.088) question?
Stock # R9748 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 11064790-11349231 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 11310542 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 962 (V962I)
Ref Sequence ENSEMBL: ENSMUSP00000057796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061318]
AlphaFold Q811B3
Predicted Effect probably damaging
Transcript: ENSMUST00000061318
AA Change: V962I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: V962I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Pep_M12B_propep 53 197 5.5e-30 PFAM
low complexity region 236 245 N/A INTRINSIC
Pfam:Reprolysin_5 248 438 1.6e-14 PFAM
Pfam:Reprolysin_4 248 453 6.7e-8 PFAM
Pfam:Reprolysin 250 460 1.2e-27 PFAM
Pfam:Reprolysin_2 268 450 5.5e-11 PFAM
Pfam:Reprolysin_3 272 407 3.5e-10 PFAM
TSP1 549 601 9.29e-14 SMART
Pfam:ADAM_spacer1 706 817 4.8e-36 PFAM
TSP1 831 887 4.66e-5 SMART
TSP1 890 949 2.54e-1 SMART
TSP1 951 1001 8.95e-7 SMART
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
TSP1 1321 1371 2.22e-2 SMART
TSP1 1372 1431 9.97e-2 SMART
TSP1 1432 1479 1.19e-2 SMART
TSP1 1480 1538 2.63e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 T C 8: 24,811,052 T221A probably benign Het
Ano3 T A 2: 110,658,295 I931F probably damaging Het
Arih1 T G 9: 59,393,298 D555A possibly damaging Het
Arsg A G 11: 109,490,626 D65G probably damaging Het
Atp8b3 G A 10: 80,528,573 T567I probably damaging Het
Camkk2 G C 5: 122,734,119 R575G probably benign Het
Ccdc88b G T 19: 6,854,093 L494M probably damaging Het
Cdc7 A G 5: 106,975,539 K317E possibly damaging Het
Cfh A G 1: 140,162,949 probably null Het
Cp T G 3: 19,989,171 V1041G possibly damaging Het
Cpeb3 A G 19: 37,174,526 V150A probably benign Het
Cyp7a1 T A 4: 6,269,216 E352V probably damaging Het
Dnah9 T A 11: 66,085,464 H1253L possibly damaging Het
Dsg3 T C 18: 20,539,704 S811P possibly damaging Het
Efcab5 A T 11: 77,116,196 Y867* probably null Het
Eif2ak1 A G 5: 143,882,213 T231A probably damaging Het
Eif2ak4 T A 2: 118,417,249 C256S probably benign Het
Eif5b A G 1: 38,051,160 N1140S possibly damaging Het
Etnppl A T 3: 130,620,353 M34L probably benign Het
Fcrl5 T G 3: 87,457,162 C549W possibly damaging Het
Fhod1 G A 8: 105,331,691 A811V probably damaging Het
Flcn C T 11: 59,802,154 S198N probably benign Het
Fndc1 T A 17: 7,773,097 H589L unknown Het
Gm10696 G A 3: 94,175,848 H219Y probably damaging Het
Gm13103 A G 4: 143,853,322 *492W probably null Het
Gm36079 T A 13: 120,026,664 E116D possibly damaging Het
Gm8108 G T 14: 4,110,527 probably benign Het
Gm8251 G T 1: 44,056,664 S1758Y possibly damaging Het
Hcn4 C T 9: 58,823,713 R68W unknown Het
Igfn1 A G 1: 135,998,598 L38P possibly damaging Het
Il1r1 A G 1: 40,310,336 T351A probably benign Het
Ildr2 T C 1: 166,269,320 L36P probably damaging Het
Itgb1bp1 C T 12: 21,274,875 C60Y probably damaging Het
Jrk A G 15: 74,707,376 L20P probably damaging Het
Kif5c C T 2: 49,694,847 A194V probably damaging Het
Lrp4 C T 2: 91,485,771 L745F probably damaging Het
Ly9 A T 1: 171,601,154 D299E possibly damaging Het
Mfsd1 C T 3: 67,592,577 T185I possibly damaging Het
Mprip A G 11: 59,765,522 Y808C probably damaging Het
Mrps2 C A 2: 28,469,582 H150Q possibly damaging Het
Mturn A T 6: 54,689,004 probably null Het
Myo5a T C 9: 75,184,683 S1205P probably damaging Het
Nckap5 G A 1: 126,026,202 P871L probably damaging Het
Ndst3 T A 3: 123,627,982 I401F probably benign Het
Nek4 G A 14: 30,987,157 V723M possibly damaging Het
Nfe2l2 A G 2: 75,676,323 S478P probably damaging Het
Nol6 T C 4: 41,123,538 Y70C probably damaging Het
Nup88 T C 11: 70,969,671 E94G probably benign Het
Oas1h A T 5: 120,867,025 N179Y probably damaging Het
Olfr108 T G 17: 37,445,704 V61G probably benign Het
Olfr887 T A 9: 38,085,057 S74T probably benign Het
Otof T C 5: 30,383,654 D847G probably damaging Het
Pak1 C A 7: 97,898,635 D331E possibly damaging Het
Pkd1l3 T C 8: 109,646,923 W1374R probably benign Het
Pkdrej G T 15: 85,820,670 T355K possibly damaging Het
Prkcd A T 14: 30,598,843 F607I possibly damaging Het
Prrc2c A G 1: 162,707,866 S775P unknown Het
Prss16 G T 13: 22,008,334 H154N possibly damaging Het
Psme2b T C 11: 48,945,952 D56G possibly damaging Het
Rapsn C T 2: 91,045,478 P400L probably damaging Het
Rptn A G 3: 93,397,454 D698G possibly damaging Het
Rragc T C 4: 123,924,865 V291A possibly damaging Het
Rras2 A G 7: 114,117,394 probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Scyl2 A C 10: 89,640,932 M777R probably benign Het
Serhl G T 15: 83,114,396 V235L probably benign Het
Sh2b3 T C 5: 121,817,811 Y536C probably damaging Het
Sh3pxd2a T C 19: 47,268,654 M570V probably benign Het
Slamf8 C T 1: 172,584,233 V232M probably benign Het
Slc6a21 T A 7: 45,280,517 L143Q probably damaging Het
Snx9 T A 17: 5,899,395 D123E probably benign Het
Soga3 A T 10: 29,148,402 D438V probably damaging Het
Supt6 C A 11: 78,217,941 R1178L probably damaging Het
Sycp2 T G 2: 178,383,511 E379D probably damaging Het
Tekt2 C T 4: 126,323,651 R207H probably damaging Het
Tg A G 15: 66,847,159 M2655V possibly damaging Het
Tiam2 C T 17: 3,511,165 T1335I probably benign Het
Tmem154 T A 3: 84,666,386 L12Q possibly damaging Het
Trpv3 A T 11: 73,283,673 I289F possibly damaging Het
Tubgcp3 A G 8: 12,649,758 L365P probably damaging Het
Tulp4 T C 17: 6,241,205 probably null Het
Tyr A G 7: 87,492,864 S163P possibly damaging Het
Usp42 A T 5: 143,727,778 probably null Het
Vmn2r94 A G 17: 18,243,727 M767T probably benign Het
Wasl A G 6: 24,619,534 V329A unknown Het
Wdr62 T A 7: 30,254,041 M635L possibly damaging Het
Wee1 G T 7: 110,122,515 E56* probably null Het
Zc3h12c C T 9: 52,143,931 G193S probably damaging Het
Zfp236 T A 18: 82,618,883 Q1426L possibly damaging Het
Zfp74 T C 7: 29,935,326 Y319C probably damaging Het
Other mutations in Adamts12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Adamts12 APN 15 11311599 missense probably benign 0.00
IGL00513:Adamts12 APN 15 11256961 missense probably benign 0.28
IGL00579:Adamts12 APN 15 11152014 missense probably benign 0.20
IGL00984:Adamts12 APN 15 11215610 missense probably benign 0.01
IGL01307:Adamts12 APN 15 11237546 missense possibly damaging 0.88
IGL01314:Adamts12 APN 15 11071853 missense probably benign 0.30
IGL01353:Adamts12 APN 15 11292005 splice site probably benign
IGL01373:Adamts12 APN 15 11310730 missense probably benign 0.00
IGL01522:Adamts12 APN 15 11065159 critical splice donor site probably null
IGL01589:Adamts12 APN 15 11311237 missense probably benign 0.26
IGL01715:Adamts12 APN 15 11258096 missense possibly damaging 0.47
IGL01966:Adamts12 APN 15 11258183 missense probably damaging 0.98
IGL01994:Adamts12 APN 15 11345594 missense probably damaging 1.00
IGL02058:Adamts12 APN 15 11215610 missense probably benign 0.01
IGL02216:Adamts12 APN 15 11241485 missense possibly damaging 0.63
IGL02252:Adamts12 APN 15 11311015 missense probably benign 0.01
IGL02336:Adamts12 APN 15 11311245 missense probably benign 0.02
IGL02445:Adamts12 APN 15 11286712 missense probably damaging 1.00
IGL03115:Adamts12 APN 15 11263336 missense probably damaging 1.00
IGL03131:Adamts12 APN 15 11345564 missense probably damaging 1.00
IGL03161:Adamts12 APN 15 11292082 missense possibly damaging 0.93
IGL03403:Adamts12 APN 15 11241488 missense probably damaging 1.00
I2289:Adamts12 UTSW 15 11071808 missense probably benign 0.13
PIT4677001:Adamts12 UTSW 15 11286810 missense probably benign 0.33
R0016:Adamts12 UTSW 15 11217829 missense probably damaging 1.00
R0016:Adamts12 UTSW 15 11217829 missense probably damaging 1.00
R0027:Adamts12 UTSW 15 11285873 missense probably damaging 0.99
R0027:Adamts12 UTSW 15 11285873 missense probably damaging 0.99
R0028:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0108:Adamts12 UTSW 15 11311098 missense probably benign 0.08
R0108:Adamts12 UTSW 15 11311098 missense probably benign 0.08
R0122:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0196:Adamts12 UTSW 15 11071508 missense probably benign 0.11
R0308:Adamts12 UTSW 15 11311560 missense probably damaging 0.98
R0335:Adamts12 UTSW 15 11311058 missense possibly damaging 0.95
R0667:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0729:Adamts12 UTSW 15 11255683 missense possibly damaging 0.91
R1162:Adamts12 UTSW 15 11277458 critical splice donor site probably null
R1173:Adamts12 UTSW 15 11071757 missense probably benign
R1174:Adamts12 UTSW 15 11071757 missense probably benign
R1319:Adamts12 UTSW 15 11286791 missense probably benign 0.02
R1344:Adamts12 UTSW 15 11286804 missense probably damaging 1.00
R1367:Adamts12 UTSW 15 11256894 splice site probably benign
R1396:Adamts12 UTSW 15 11311472 missense probably benign 0.01
R1418:Adamts12 UTSW 15 11286804 missense probably damaging 1.00
R1447:Adamts12 UTSW 15 11263361 missense probably benign 0.42
R1466:Adamts12 UTSW 15 11311359 missense probably benign
R1466:Adamts12 UTSW 15 11311359 missense probably benign
R1599:Adamts12 UTSW 15 11071711 missense probably damaging 0.99
R1700:Adamts12 UTSW 15 11152057 missense probably benign 0.00
R1748:Adamts12 UTSW 15 11241462 missense probably damaging 0.99
R1826:Adamts12 UTSW 15 11071520 missense probably benign 0.06
R1870:Adamts12 UTSW 15 11311154 missense probably benign 0.06
R1871:Adamts12 UTSW 15 11311154 missense probably benign 0.06
R1872:Adamts12 UTSW 15 11217880 nonsense probably null
R1931:Adamts12 UTSW 15 11270599 missense probably benign 0.00
R2041:Adamts12 UTSW 15 11215735 missense probably damaging 1.00
R2119:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2120:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2122:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2161:Adamts12 UTSW 15 11215735 missense probably damaging 0.99
R2655:Adamts12 UTSW 15 11065088 missense possibly damaging 0.50
R4010:Adamts12 UTSW 15 11286083 missense possibly damaging 0.69
R4208:Adamts12 UTSW 15 11071754 missense probably benign
R4666:Adamts12 UTSW 15 11311492 missense probably benign 0.08
R4731:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4732:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4733:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4766:Adamts12 UTSW 15 11285901 missense probably benign 0.03
R4877:Adamts12 UTSW 15 11327701 missense probably damaging 1.00
R4929:Adamts12 UTSW 15 11259022 missense probably damaging 0.96
R5060:Adamts12 UTSW 15 11299968 missense probably damaging 1.00
R5145:Adamts12 UTSW 15 11285876 missense probably damaging 1.00
R5191:Adamts12 UTSW 15 11327757 missense probably benign 0.18
R5492:Adamts12 UTSW 15 11336298 missense probably benign 0.05
R5580:Adamts12 UTSW 15 11152000 missense probably benign 0.14
R5645:Adamts12 UTSW 15 11277420 missense possibly damaging 0.92
R5724:Adamts12 UTSW 15 11286750 missense probably benign 0.15
R6240:Adamts12 UTSW 15 11285958 missense probably benign 0.44
R6331:Adamts12 UTSW 15 11241433 missense probably damaging 1.00
R6381:Adamts12 UTSW 15 11256994 missense possibly damaging 0.93
R6393:Adamts12 UTSW 15 11255635 missense probably damaging 0.97
R6419:Adamts12 UTSW 15 11215673 missense possibly damaging 0.72
R6571:Adamts12 UTSW 15 11065101 missense probably benign 0.00
R6821:Adamts12 UTSW 15 11152048 missense probably benign 0.14
R6913:Adamts12 UTSW 15 11215692 missense probably damaging 1.00
R6973:Adamts12 UTSW 15 11331780 nonsense probably null
R7188:Adamts12 UTSW 15 11336325 nonsense probably null
R7290:Adamts12 UTSW 15 11277366 missense probably benign 0.08
R7307:Adamts12 UTSW 15 11217813 missense probably damaging 1.00
R7376:Adamts12 UTSW 15 11277339 missense possibly damaging 0.69
R7419:Adamts12 UTSW 15 11317279 missense probably benign 0.00
R7484:Adamts12 UTSW 15 11345648 missense probably benign 0.25
R7562:Adamts12 UTSW 15 11270611 missense probably benign 0.01
R7653:Adamts12 UTSW 15 11257029 missense probably benign 0.28
R7696:Adamts12 UTSW 15 11258138 missense probably damaging 1.00
R7957:Adamts12 UTSW 15 11317212 missense possibly damaging 0.96
R7980:Adamts12 UTSW 15 11263337 missense probably damaging 1.00
R7992:Adamts12 UTSW 15 11310818 missense probably benign
R8032:Adamts12 UTSW 15 11259103 critical splice donor site probably null
R8109:Adamts12 UTSW 15 11331791 missense probably benign 0.02
R8402:Adamts12 UTSW 15 11263290 missense probably damaging 0.96
R8751:Adamts12 UTSW 15 11215727 missense probably damaging 1.00
R8782:Adamts12 UTSW 15 11237592 missense probably damaging 1.00
R8934:Adamts12 UTSW 15 11299929 missense probably damaging 0.99
R8952:Adamts12 UTSW 15 11285979 missense probably damaging 1.00
R8963:Adamts12 UTSW 15 11317357 critical splice donor site probably null
R9042:Adamts12 UTSW 15 11152048 missense probably benign 0.08
R9162:Adamts12 UTSW 15 11311635 missense probably benign 0.29
R9190:Adamts12 UTSW 15 11336360 missense probably benign 0.02
R9700:Adamts12 UTSW 15 11311356 missense probably benign 0.04
V1662:Adamts12 UTSW 15 11071808 missense probably benign 0.13
X0022:Adamts12 UTSW 15 11277448 missense probably benign 0.30
Z1176:Adamts12 UTSW 15 11336383 missense not run
Z1177:Adamts12 UTSW 15 11317324 missense probably damaging 1.00
Z1177:Adamts12 UTSW 15 11336383 missense not run
Predicted Primers PCR Primer
(F):5'- AGAGCCTTCGGTTTGACTGTATC -3'
(R):5'- TGTGCTCATAGACTCAGGCAC -3'

Sequencing Primer
(F):5'- CCTTCGGTTTGACTGTATCTTGGG -3'
(R):5'- GTCGATTGATTTTTCCCACTGG -3'
Posted On 2022-11-14