Incidental Mutation 'R9749:Csmd2'
ID 732393
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene Name CUB and Sushi multiple domains 2
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R9749 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 127881650-128461449 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 128389921 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 2219 (I2219F)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000184063]
AlphaFold no structure available at present
Predicted Effect
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T A 11: 72,080,521 (GRCm39) I382F possibly damaging Het
Adamtsl3 A G 7: 82,099,394 (GRCm39) S183G probably benign Het
Adamtsl4 T C 3: 95,591,457 (GRCm39) H170R probably benign Het
Adcy2 T C 13: 68,773,974 (GRCm39) D1023G probably damaging Het
Agrn C A 4: 156,258,114 (GRCm39) V1083F probably benign Het
Arhgap21 T C 2: 20,854,026 (GRCm39) T1789A probably benign Het
Atr T C 9: 95,819,703 (GRCm39) probably null Het
Bcl2l13 T C 6: 120,842,633 (GRCm39) S109P possibly damaging Het
Bik A T 15: 83,425,540 (GRCm39) T14S possibly damaging Het
Car7 A G 8: 105,275,054 (GRCm39) D164G probably damaging Het
Cat T A 2: 103,285,445 (GRCm39) K499M probably benign Het
Ccar2 T A 14: 70,388,728 (GRCm39) Q161L probably benign Het
Cd109 T G 9: 78,592,166 (GRCm39) V760G probably damaging Het
Cep350 A T 1: 155,828,985 (GRCm39) H246Q probably benign Het
Cfap91 A G 16: 38,128,487 (GRCm39) I496T probably damaging Het
Chst13 T C 6: 90,295,251 (GRCm39) D54G probably damaging Het
Cilk1 T A 9: 78,060,999 (GRCm39) V215E probably damaging Het
Col4a4 A G 1: 82,463,353 (GRCm39) S1046P unknown Het
Col6a5 T C 9: 105,739,190 (GRCm39) Q2581R probably damaging Het
Cox5b-ps G A 13: 21,685,515 (GRCm39) A25V probably benign Het
Cux2 G A 5: 122,007,780 (GRCm39) S627L possibly damaging Het
Cyp2a22 A T 7: 26,638,715 (GRCm39) W24R probably null Het
Dhrs7c A T 11: 67,702,479 (GRCm39) T156S probably damaging Het
Dnah9 A G 11: 65,986,202 (GRCm39) V1144A probably damaging Het
Folh1 T C 7: 86,368,908 (GRCm39) T740A probably damaging Het
Foxo4 G A X: 100,301,955 (GRCm39) S209N probably benign Het
Gm10300 A G 4: 131,802,029 (GRCm39) T8A unknown Het
Gns T A 10: 121,214,057 (GRCm39) I244N probably benign Het
Gsdmd A G 15: 75,735,411 (GRCm39) K52E probably damaging Het
H1f0 A G 15: 78,913,217 (GRCm39) D99G probably benign Het
Hapln4 T C 8: 70,539,724 (GRCm39) Y252H probably damaging Het
Hmcn1 A C 1: 150,632,339 (GRCm39) I866S possibly damaging Het
Hrnr C T 3: 93,231,384 (GRCm39) R541C unknown Het
Igkv4-57-1 A G 6: 69,521,408 (GRCm39) I98T probably damaging Het
Itih3 T A 14: 30,641,279 (GRCm39) D253V probably damaging Het
Kansl1l T A 1: 66,760,970 (GRCm39) E869D probably damaging Het
Kif13a T C 13: 46,914,227 (GRCm39) Q502R probably damaging Het
Lama5 T A 2: 179,825,433 (GRCm39) Q2447L probably benign Het
Lcn6 A T 2: 25,570,034 (GRCm39) M1L probably benign Het
Lrrtm1 T C 6: 77,220,855 (GRCm39) V104A probably damaging Het
Map3k13 T C 16: 21,740,581 (GRCm39) L636P probably benign Het
Melk T A 4: 44,307,067 (GRCm39) H74Q possibly damaging Het
Mixl1 A T 1: 180,522,311 (GRCm39) M190K probably benign Het
Mttp A G 3: 137,830,989 (GRCm39) S27P probably damaging Het
Myh6 T C 14: 55,190,943 (GRCm39) I911V probably damaging Het
Ncapd3 T A 9: 26,956,873 (GRCm39) I262N probably benign Het
Ncapg2 C A 12: 116,411,368 (GRCm39) S1051* probably null Het
Nckap1 G A 2: 80,401,568 (GRCm39) Q39* probably null Het
Nemp1 A G 10: 127,524,198 (GRCm39) D76G probably benign Het
Or12e10 A C 2: 87,640,202 (GRCm39) K13Q probably benign Het
Or2a20 G A 6: 43,194,258 (GRCm39) W137* probably null Het
Or2l13 A T 16: 19,306,113 (GRCm39) H175L possibly damaging Het
Or4a2 T A 2: 89,248,662 (GRCm39) I32F possibly damaging Het
Or8k36-ps1 T C 2: 86,437,909 (GRCm39) E2G probably benign Het
Osbpl5 C A 7: 143,249,308 (GRCm39) V578L probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Rabl3 A G 16: 37,377,190 (GRCm39) D49G possibly damaging Het
Rngtt A G 4: 33,368,618 (GRCm39) I384V possibly damaging Het
Robo1 T C 16: 72,105,257 (GRCm39) probably benign Het
Rtcb C A 10: 85,785,453 (GRCm39) R125L probably damaging Het
Rtn4rl2 C A 2: 84,702,954 (GRCm39) R206L probably damaging Het
Sbk2 A T 7: 4,960,333 (GRCm39) I279N probably benign Het
Scaf1 A G 7: 44,656,576 (GRCm39) S768P unknown Het
Slc6a9 A G 4: 117,721,198 (GRCm39) H316R probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,453,579 (GRCm39) probably benign Het
Tas2r136 G T 6: 132,755,106 (GRCm39) T7K probably damaging Het
Tbc1d9 T A 8: 83,968,339 (GRCm39) probably null Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tmem40 T C 6: 115,719,306 (GRCm39) D53G probably benign Het
Tram1 A T 1: 13,640,238 (GRCm39) V272D possibly damaging Het
Trpc4 G A 3: 54,102,302 (GRCm39) D67N probably damaging Het
Ttc6 A T 12: 57,701,559 (GRCm39) T591S probably benign Het
Ube2g1 A T 11: 72,570,199 (GRCm39) E144V probably benign Het
Unc80 A G 1: 66,544,179 (GRCm39) D434G probably damaging Het
Vmn1r168 C A 7: 23,240,237 (GRCm39) N31K probably damaging Het
Vmn1r79 A T 7: 11,910,450 (GRCm39) T111S probably damaging Het
Vmn2r118 C T 17: 55,915,415 (GRCm39) probably null Het
Vps35l C A 7: 118,352,107 (GRCm39) D195E probably benign Het
Yy1 A G 12: 108,772,417 (GRCm39) D231G possibly damaging Het
Zfp748 A G 13: 67,690,573 (GRCm39) V229A probably benign Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128,377,266 (GRCm39) missense probably benign 0.03
IGL01098:Csmd2 APN 4 127,952,845 (GRCm39) missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128,262,923 (GRCm39) missense probably benign 0.04
IGL01364:Csmd2 APN 4 128,308,081 (GRCm39) missense probably benign 0.01
IGL01530:Csmd2 APN 4 128,308,094 (GRCm39) missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128,457,098 (GRCm39) nonsense probably null
IGL01670:Csmd2 APN 4 128,407,164 (GRCm39) splice site probably benign
IGL01707:Csmd2 APN 4 128,276,798 (GRCm39) missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128,374,638 (GRCm39) splice site probably benign
IGL01837:Csmd2 APN 4 128,313,363 (GRCm39) missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128,453,740 (GRCm39) missense unknown
IGL02013:Csmd2 APN 4 128,215,116 (GRCm39) missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128,453,672 (GRCm39) missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128,371,263 (GRCm39) splice site probably benign
IGL02303:Csmd2 APN 4 128,262,801 (GRCm39) missense probably benign 0.01
IGL02317:Csmd2 APN 4 128,357,520 (GRCm39) splice site probably benign
IGL02322:Csmd2 APN 4 128,357,520 (GRCm39) splice site probably benign
IGL02338:Csmd2 APN 4 128,288,859 (GRCm39) missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128,407,165 (GRCm39) splice site probably benign
IGL02428:Csmd2 APN 4 128,368,609 (GRCm39) missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128,428,050 (GRCm39) missense probably benign
IGL02701:Csmd2 APN 4 128,389,934 (GRCm39) missense probably benign 0.17
IGL02801:Csmd2 APN 4 128,445,868 (GRCm39) splice site probably null
IGL02818:Csmd2 APN 4 128,103,521 (GRCm39) missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128,415,677 (GRCm39) missense probably benign 0.00
IGL02876:Csmd2 APN 4 128,215,128 (GRCm39) nonsense probably null
IGL02977:Csmd2 APN 4 128,387,069 (GRCm39) nonsense probably null
IGL03006:Csmd2 APN 4 128,374,558 (GRCm39) splice site probably benign
IGL03032:Csmd2 APN 4 128,412,834 (GRCm39) missense probably benign 0.03
IGL03148:Csmd2 APN 4 128,278,062 (GRCm39) missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128,308,092 (GRCm39) nonsense probably null
IGL03245:Csmd2 APN 4 128,402,915 (GRCm39) missense probably benign 0.12
IGL03376:Csmd2 APN 4 128,411,464 (GRCm39) missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128,190,222 (GRCm39) missense probably benign 0.01
R0109:Csmd2 UTSW 4 128,438,536 (GRCm39) missense probably benign 0.03
R0112:Csmd2 UTSW 4 128,389,822 (GRCm39) missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128,415,704 (GRCm39) missense probably benign 0.02
R0390:Csmd2 UTSW 4 128,027,466 (GRCm39) intron probably benign
R0441:Csmd2 UTSW 4 128,414,023 (GRCm39) missense probably benign 0.00
R0519:Csmd2 UTSW 4 128,380,798 (GRCm39) missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128,007,469 (GRCm39) missense probably benign 0.00
R0746:Csmd2 UTSW 4 128,308,090 (GRCm39) missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128,389,981 (GRCm39) missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128,415,807 (GRCm39) missense probably benign 0.00
R1476:Csmd2 UTSW 4 128,380,794 (GRCm39) missense probably benign 0.08
R1641:Csmd2 UTSW 4 128,377,188 (GRCm39) missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128,389,988 (GRCm39) missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128,308,185 (GRCm39) critical splice donor site probably null
R2870:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2870:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2871:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2871:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2872:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2872:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2873:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2893:Csmd2 UTSW 4 128,432,786 (GRCm39) splice site probably null
R3796:Csmd2 UTSW 4 128,411,388 (GRCm39) missense probably benign 0.20
R3797:Csmd2 UTSW 4 128,411,388 (GRCm39) missense probably benign 0.20
R3798:Csmd2 UTSW 4 128,411,388 (GRCm39) missense probably benign 0.20
R3914:Csmd2 UTSW 4 128,215,117 (GRCm39) missense probably benign 0.07
R4198:Csmd2 UTSW 4 128,404,717 (GRCm39) missense probably benign 0.07
R4489:Csmd2 UTSW 4 128,275,738 (GRCm39) missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128,373,888 (GRCm39) splice site probably null
R4581:Csmd2 UTSW 4 128,262,881 (GRCm39) missense probably benign 0.02
R4599:Csmd2 UTSW 4 127,881,921 (GRCm39) missense probably benign 0.35
R4649:Csmd2 UTSW 4 128,439,866 (GRCm39) missense probably benign
R4706:Csmd2 UTSW 4 128,438,544 (GRCm39) missense probably benign
R4776:Csmd2 UTSW 4 128,336,685 (GRCm39) missense probably benign 0.09
R4838:Csmd2 UTSW 4 128,411,542 (GRCm39) missense probably benign
R4900:Csmd2 UTSW 4 128,346,318 (GRCm39) missense probably benign 0.03
R4999:Csmd2 UTSW 4 128,415,723 (GRCm39) missense probably benign 0.00
R5024:Csmd2 UTSW 4 128,215,141 (GRCm39) missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 127,952,901 (GRCm39) missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128,445,828 (GRCm39) missense probably benign 0.27
R5172:Csmd2 UTSW 4 128,371,190 (GRCm39) missense probably benign 0.10
R5231:Csmd2 UTSW 4 128,439,842 (GRCm39) missense probably benign 0.00
R5279:Csmd2 UTSW 4 128,350,707 (GRCm39) missense probably benign 0.30
R5287:Csmd2 UTSW 4 128,380,677 (GRCm39) missense probably benign 0.01
R5403:Csmd2 UTSW 4 128,380,677 (GRCm39) missense probably benign 0.01
R5410:Csmd2 UTSW 4 128,442,612 (GRCm39) missense probably benign
R5551:Csmd2 UTSW 4 128,404,741 (GRCm39) missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128,356,682 (GRCm39) critical splice donor site probably null
R5826:Csmd2 UTSW 4 128,412,992 (GRCm39) splice site probably null
R5907:Csmd2 UTSW 4 128,091,178 (GRCm39) missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128,445,781 (GRCm39) missense probably benign 0.01
R5970:Csmd2 UTSW 4 128,439,944 (GRCm39) missense probably benign 0.00
R5977:Csmd2 UTSW 4 127,952,827 (GRCm39) missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128,453,739 (GRCm39) missense unknown
R6075:Csmd2 UTSW 4 128,380,658 (GRCm39) missense probably benign 0.15
R6129:Csmd2 UTSW 4 128,387,127 (GRCm39) missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128,294,172 (GRCm39) missense probably benign 0.00
R6366:Csmd2 UTSW 4 128,377,245 (GRCm39) missense probably benign 0.00
R6404:Csmd2 UTSW 4 128,415,743 (GRCm39) missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127,881,893 (GRCm39) missense probably benign 0.24
R6441:Csmd2 UTSW 4 128,288,757 (GRCm39) missense probably benign 0.03
R6643:Csmd2 UTSW 4 128,266,390 (GRCm39) missense probably benign 0.14
R6724:Csmd2 UTSW 4 128,457,164 (GRCm39) missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128,357,606 (GRCm39) missense probably benign 0.00
R6750:Csmd2 UTSW 4 128,091,018 (GRCm39) missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128,277,743 (GRCm39) missense probably benign 0.11
R6842:Csmd2 UTSW 4 128,402,952 (GRCm39) missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128,357,587 (GRCm39) missense probably benign 0.27
R6868:Csmd2 UTSW 4 128,336,633 (GRCm39) missense probably benign
R6882:Csmd2 UTSW 4 128,343,062 (GRCm39) missense probably benign 0.01
R7019:Csmd2 UTSW 4 128,262,856 (GRCm39) missense
R7028:Csmd2 UTSW 4 128,171,021 (GRCm39) missense
R7096:Csmd2 UTSW 4 128,356,519 (GRCm39) missense
R7122:Csmd2 UTSW 4 128,343,020 (GRCm39) missense
R7125:Csmd2 UTSW 4 128,389,955 (GRCm39) missense
R7197:Csmd2 UTSW 4 128,404,826 (GRCm39) missense
R7234:Csmd2 UTSW 4 128,350,572 (GRCm39) missense
R7299:Csmd2 UTSW 4 128,422,055 (GRCm39) missense
R7301:Csmd2 UTSW 4 128,422,055 (GRCm39) missense
R7319:Csmd2 UTSW 4 128,287,472 (GRCm39) missense
R7331:Csmd2 UTSW 4 128,458,021 (GRCm39) splice site probably null
R7332:Csmd2 UTSW 4 128,313,360 (GRCm39) missense
R7352:Csmd2 UTSW 4 128,451,429 (GRCm39) missense
R7402:Csmd2 UTSW 4 128,215,889 (GRCm39) missense
R7402:Csmd2 UTSW 4 128,215,888 (GRCm39) missense
R7474:Csmd2 UTSW 4 128,439,920 (GRCm39) missense
R7555:Csmd2 UTSW 4 128,346,251 (GRCm39) missense
R7592:Csmd2 UTSW 4 128,357,591 (GRCm39) missense
R7700:Csmd2 UTSW 4 128,439,549 (GRCm39) splice site probably null
R7714:Csmd2 UTSW 4 128,276,743 (GRCm39) nonsense probably null
R7734:Csmd2 UTSW 4 128,445,850 (GRCm39) missense
R7735:Csmd2 UTSW 4 128,350,723 (GRCm39) critical splice donor site probably null
R7757:Csmd2 UTSW 4 128,377,249 (GRCm39) missense
R7805:Csmd2 UTSW 4 128,313,366 (GRCm39) missense
R7823:Csmd2 UTSW 4 128,103,698 (GRCm39) missense
R7904:Csmd2 UTSW 4 128,313,346 (GRCm39) missense
R7946:Csmd2 UTSW 4 128,414,058 (GRCm39) missense
R7964:Csmd2 UTSW 4 128,417,303 (GRCm39) missense
R7968:Csmd2 UTSW 4 128,091,118 (GRCm39) missense
R8003:Csmd2 UTSW 4 128,432,980 (GRCm39) nonsense probably null
R8071:Csmd2 UTSW 4 128,287,331 (GRCm39) missense
R8504:Csmd2 UTSW 4 128,440,483 (GRCm39) missense
R8511:Csmd2 UTSW 4 128,262,692 (GRCm39) missense
R8517:Csmd2 UTSW 4 128,446,479 (GRCm39) missense
R8704:Csmd2 UTSW 4 128,091,147 (GRCm39) missense
R8722:Csmd2 UTSW 4 128,445,743 (GRCm39) unclassified probably benign
R8729:Csmd2 UTSW 4 128,356,638 (GRCm39) missense
R8801:Csmd2 UTSW 4 128,457,195 (GRCm39) missense probably damaging 0.97
R8803:Csmd2 UTSW 4 128,440,477 (GRCm39) missense
R8839:Csmd2 UTSW 4 128,336,681 (GRCm39) missense
R8867:Csmd2 UTSW 4 128,451,469 (GRCm39) missense
R8913:Csmd2 UTSW 4 128,417,351 (GRCm39) missense
R8928:Csmd2 UTSW 4 128,369,582 (GRCm39) missense
R8974:Csmd2 UTSW 4 128,446,380 (GRCm39) missense
R9001:Csmd2 UTSW 4 128,308,079 (GRCm39) missense
R9132:Csmd2 UTSW 4 128,443,007 (GRCm39) missense
R9245:Csmd2 UTSW 4 128,200,168 (GRCm39) missense
R9249:Csmd2 UTSW 4 128,313,323 (GRCm39) nonsense probably null
R9254:Csmd2 UTSW 4 128,091,112 (GRCm39) missense
R9265:Csmd2 UTSW 4 128,294,163 (GRCm39) missense
R9407:Csmd2 UTSW 4 128,442,613 (GRCm39) missense
R9432:Csmd2 UTSW 4 128,171,004 (GRCm39) missense
R9559:Csmd2 UTSW 4 128,438,561 (GRCm39) missense
R9673:Csmd2 UTSW 4 128,308,062 (GRCm39) missense
R9735:Csmd2 UTSW 4 128,402,901 (GRCm39) missense
R9803:Csmd2 UTSW 4 128,262,986 (GRCm39) missense
Z1177:Csmd2 UTSW 4 128,424,590 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- ACTGAGAACTGAGGTTTTACGGG -3'
(R):5'- CCCTTCTTAGTCTGGACAGC -3'

Sequencing Primer
(F):5'- CTGAGGTTTTACGGGGAAGACATC -3'
(R):5'- TGCAGAGTAAGCCTGCATAAC -3'
Posted On 2022-11-14