Incidental Mutation 'R9749:Vmn2r118'
ID 732448
Institutional Source Beutler Lab
Gene Symbol Vmn2r118
Ensembl Gene ENSMUSG00000091504
Gene Name vomeronasal 2, receptor 118
Synonyms Vmn2r119, EG668547, EG383258
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.128) question?
Stock # R9749 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 55899341-55931672 bp(-) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 55915415 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168440]
AlphaFold E9Q1C1
Predicted Effect probably null
Transcript: ENSMUST00000168440
SMART Domains Protein: ENSMUSP00000131128
Gene: ENSMUSG00000091504

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 142 470 4.6e-27 PFAM
Pfam:NCD3G 513 566 2.6e-20 PFAM
Pfam:7tm_3 599 834 5.9e-55 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T A 11: 72,080,521 (GRCm39) I382F possibly damaging Het
Adamtsl3 A G 7: 82,099,394 (GRCm39) S183G probably benign Het
Adamtsl4 T C 3: 95,591,457 (GRCm39) H170R probably benign Het
Adcy2 T C 13: 68,773,974 (GRCm39) D1023G probably damaging Het
Agrn C A 4: 156,258,114 (GRCm39) V1083F probably benign Het
Arhgap21 T C 2: 20,854,026 (GRCm39) T1789A probably benign Het
Atr T C 9: 95,819,703 (GRCm39) probably null Het
Bcl2l13 T C 6: 120,842,633 (GRCm39) S109P possibly damaging Het
Bik A T 15: 83,425,540 (GRCm39) T14S possibly damaging Het
Car7 A G 8: 105,275,054 (GRCm39) D164G probably damaging Het
Cat T A 2: 103,285,445 (GRCm39) K499M probably benign Het
Ccar2 T A 14: 70,388,728 (GRCm39) Q161L probably benign Het
Cd109 T G 9: 78,592,166 (GRCm39) V760G probably damaging Het
Cep350 A T 1: 155,828,985 (GRCm39) H246Q probably benign Het
Cfap91 A G 16: 38,128,487 (GRCm39) I496T probably damaging Het
Chst13 T C 6: 90,295,251 (GRCm39) D54G probably damaging Het
Cilk1 T A 9: 78,060,999 (GRCm39) V215E probably damaging Het
Col4a4 A G 1: 82,463,353 (GRCm39) S1046P unknown Het
Col6a5 T C 9: 105,739,190 (GRCm39) Q2581R probably damaging Het
Cox5b-ps G A 13: 21,685,515 (GRCm39) A25V probably benign Het
Csmd2 A T 4: 128,389,921 (GRCm39) I2219F Het
Cux2 G A 5: 122,007,780 (GRCm39) S627L possibly damaging Het
Cyp2a22 A T 7: 26,638,715 (GRCm39) W24R probably null Het
Dhrs7c A T 11: 67,702,479 (GRCm39) T156S probably damaging Het
Dnah9 A G 11: 65,986,202 (GRCm39) V1144A probably damaging Het
Folh1 T C 7: 86,368,908 (GRCm39) T740A probably damaging Het
Foxo4 G A X: 100,301,955 (GRCm39) S209N probably benign Het
Gm10300 A G 4: 131,802,029 (GRCm39) T8A unknown Het
Gns T A 10: 121,214,057 (GRCm39) I244N probably benign Het
Gsdmd A G 15: 75,735,411 (GRCm39) K52E probably damaging Het
H1f0 A G 15: 78,913,217 (GRCm39) D99G probably benign Het
Hapln4 T C 8: 70,539,724 (GRCm39) Y252H probably damaging Het
Hmcn1 A C 1: 150,632,339 (GRCm39) I866S possibly damaging Het
Hrnr C T 3: 93,231,384 (GRCm39) R541C unknown Het
Igkv4-57-1 A G 6: 69,521,408 (GRCm39) I98T probably damaging Het
Itih3 T A 14: 30,641,279 (GRCm39) D253V probably damaging Het
Kansl1l T A 1: 66,760,970 (GRCm39) E869D probably damaging Het
Kif13a T C 13: 46,914,227 (GRCm39) Q502R probably damaging Het
Lama5 T A 2: 179,825,433 (GRCm39) Q2447L probably benign Het
Lcn6 A T 2: 25,570,034 (GRCm39) M1L probably benign Het
Lrrtm1 T C 6: 77,220,855 (GRCm39) V104A probably damaging Het
Map3k13 T C 16: 21,740,581 (GRCm39) L636P probably benign Het
Melk T A 4: 44,307,067 (GRCm39) H74Q possibly damaging Het
Mixl1 A T 1: 180,522,311 (GRCm39) M190K probably benign Het
Mttp A G 3: 137,830,989 (GRCm39) S27P probably damaging Het
Myh6 T C 14: 55,190,943 (GRCm39) I911V probably damaging Het
Ncapd3 T A 9: 26,956,873 (GRCm39) I262N probably benign Het
Ncapg2 C A 12: 116,411,368 (GRCm39) S1051* probably null Het
Nckap1 G A 2: 80,401,568 (GRCm39) Q39* probably null Het
Nemp1 A G 10: 127,524,198 (GRCm39) D76G probably benign Het
Or12e10 A C 2: 87,640,202 (GRCm39) K13Q probably benign Het
Or2a20 G A 6: 43,194,258 (GRCm39) W137* probably null Het
Or2l13 A T 16: 19,306,113 (GRCm39) H175L possibly damaging Het
Or4a2 T A 2: 89,248,662 (GRCm39) I32F possibly damaging Het
Or8k36-ps1 T C 2: 86,437,909 (GRCm39) E2G probably benign Het
Osbpl5 C A 7: 143,249,308 (GRCm39) V578L probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Rabl3 A G 16: 37,377,190 (GRCm39) D49G possibly damaging Het
Rngtt A G 4: 33,368,618 (GRCm39) I384V possibly damaging Het
Robo1 T C 16: 72,105,257 (GRCm39) probably benign Het
Rtcb C A 10: 85,785,453 (GRCm39) R125L probably damaging Het
Rtn4rl2 C A 2: 84,702,954 (GRCm39) R206L probably damaging Het
Sbk2 A T 7: 4,960,333 (GRCm39) I279N probably benign Het
Scaf1 A G 7: 44,656,576 (GRCm39) S768P unknown Het
Slc6a9 A G 4: 117,721,198 (GRCm39) H316R probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,453,579 (GRCm39) probably benign Het
Tas2r136 G T 6: 132,755,106 (GRCm39) T7K probably damaging Het
Tbc1d9 T A 8: 83,968,339 (GRCm39) probably null Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tmem40 T C 6: 115,719,306 (GRCm39) D53G probably benign Het
Tram1 A T 1: 13,640,238 (GRCm39) V272D possibly damaging Het
Trpc4 G A 3: 54,102,302 (GRCm39) D67N probably damaging Het
Ttc6 A T 12: 57,701,559 (GRCm39) T591S probably benign Het
Ube2g1 A T 11: 72,570,199 (GRCm39) E144V probably benign Het
Unc80 A G 1: 66,544,179 (GRCm39) D434G probably damaging Het
Vmn1r168 C A 7: 23,240,237 (GRCm39) N31K probably damaging Het
Vmn1r79 A T 7: 11,910,450 (GRCm39) T111S probably damaging Het
Vps35l C A 7: 118,352,107 (GRCm39) D195E probably benign Het
Yy1 A G 12: 108,772,417 (GRCm39) D231G possibly damaging Het
Zfp748 A G 13: 67,690,573 (GRCm39) V229A probably benign Het
Other mutations in Vmn2r118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Vmn2r118 APN 17 55,899,708 (GRCm39) missense probably damaging 1.00
IGL00976:Vmn2r118 APN 17 55,900,204 (GRCm39) missense probably damaging 1.00
IGL01419:Vmn2r118 APN 17 55,900,000 (GRCm39) missense probably benign 0.01
IGL01796:Vmn2r118 APN 17 55,915,585 (GRCm39) missense probably benign 0.30
IGL01799:Vmn2r118 APN 17 55,899,990 (GRCm39) missense probably damaging 1.00
IGL02002:Vmn2r118 APN 17 55,899,619 (GRCm39) missense probably damaging 1.00
IGL02075:Vmn2r118 APN 17 55,917,517 (GRCm39) missense probably benign 0.18
IGL02172:Vmn2r118 APN 17 55,931,598 (GRCm39) missense probably benign 0.00
IGL02529:Vmn2r118 APN 17 55,917,870 (GRCm39) missense possibly damaging 0.58
IGL02712:Vmn2r118 APN 17 55,899,655 (GRCm39) missense probably benign 0.21
IGL03096:Vmn2r118 APN 17 55,914,996 (GRCm39) missense probably damaging 1.00
R0306:Vmn2r118 UTSW 17 55,915,616 (GRCm39) missense possibly damaging 0.89
R0329:Vmn2r118 UTSW 17 55,917,717 (GRCm39) missense probably damaging 1.00
R0330:Vmn2r118 UTSW 17 55,917,717 (GRCm39) missense probably damaging 1.00
R0396:Vmn2r118 UTSW 17 55,915,643 (GRCm39) missense probably benign 0.00
R0411:Vmn2r118 UTSW 17 55,918,021 (GRCm39) splice site probably benign
R0513:Vmn2r118 UTSW 17 55,917,970 (GRCm39) nonsense probably null
R0627:Vmn2r118 UTSW 17 55,917,772 (GRCm39) missense probably benign 0.01
R0638:Vmn2r118 UTSW 17 55,915,466 (GRCm39) missense probably benign 0.03
R1328:Vmn2r118 UTSW 17 55,915,620 (GRCm39) missense probably benign 0.01
R1366:Vmn2r118 UTSW 17 55,900,237 (GRCm39) nonsense probably null
R1465:Vmn2r118 UTSW 17 55,917,935 (GRCm39) missense probably benign 0.33
R1465:Vmn2r118 UTSW 17 55,917,935 (GRCm39) missense probably benign 0.33
R1511:Vmn2r118 UTSW 17 55,915,496 (GRCm39) nonsense probably null
R1515:Vmn2r118 UTSW 17 55,917,643 (GRCm39) missense probably benign 0.25
R1550:Vmn2r118 UTSW 17 55,915,083 (GRCm39) missense probably damaging 1.00
R1779:Vmn2r118 UTSW 17 55,918,530 (GRCm39) missense probably benign 0.03
R1834:Vmn2r118 UTSW 17 55,899,456 (GRCm39) missense probably damaging 1.00
R1840:Vmn2r118 UTSW 17 55,917,406 (GRCm39) nonsense probably null
R1854:Vmn2r118 UTSW 17 55,918,556 (GRCm39) missense possibly damaging 0.57
R1967:Vmn2r118 UTSW 17 55,899,882 (GRCm39) missense probably damaging 1.00
R1976:Vmn2r118 UTSW 17 55,899,925 (GRCm39) missense probably damaging 1.00
R2308:Vmn2r118 UTSW 17 55,931,650 (GRCm39) missense probably benign 0.33
R3700:Vmn2r118 UTSW 17 55,915,421 (GRCm39) missense possibly damaging 0.68
R4334:Vmn2r118 UTSW 17 55,917,347 (GRCm39) missense possibly damaging 0.58
R4647:Vmn2r118 UTSW 17 55,917,665 (GRCm39) missense probably damaging 1.00
R4709:Vmn2r118 UTSW 17 55,917,860 (GRCm39) missense probably damaging 1.00
R4805:Vmn2r118 UTSW 17 55,899,581 (GRCm39) missense probably damaging 1.00
R4858:Vmn2r118 UTSW 17 55,899,894 (GRCm39) missense probably damaging 0.98
R5384:Vmn2r118 UTSW 17 55,918,565 (GRCm39) missense probably benign 0.00
R5385:Vmn2r118 UTSW 17 55,918,565 (GRCm39) missense probably benign 0.00
R5664:Vmn2r118 UTSW 17 55,899,765 (GRCm39) missense possibly damaging 0.46
R5740:Vmn2r118 UTSW 17 55,900,103 (GRCm39) missense probably benign 0.00
R5927:Vmn2r118 UTSW 17 55,931,494 (GRCm39) missense probably benign 0.04
R6143:Vmn2r118 UTSW 17 55,899,871 (GRCm39) missense possibly damaging 0.92
R6513:Vmn2r118 UTSW 17 55,915,093 (GRCm39) missense probably damaging 1.00
R6573:Vmn2r118 UTSW 17 55,899,996 (GRCm39) missense probably damaging 1.00
R6760:Vmn2r118 UTSW 17 55,899,714 (GRCm39) missense possibly damaging 0.92
R6794:Vmn2r118 UTSW 17 55,899,348 (GRCm39) missense possibly damaging 0.48
R6929:Vmn2r118 UTSW 17 55,917,440 (GRCm39) missense probably benign 0.01
R7201:Vmn2r118 UTSW 17 55,915,496 (GRCm39) nonsense probably null
R7539:Vmn2r118 UTSW 17 55,899,853 (GRCm39) missense probably damaging 0.98
R7836:Vmn2r118 UTSW 17 55,900,242 (GRCm39) missense probably damaging 0.99
R8179:Vmn2r118 UTSW 17 55,915,484 (GRCm39) missense probably benign 0.36
R8248:Vmn2r118 UTSW 17 55,917,936 (GRCm39) missense probably benign 0.18
R8347:Vmn2r118 UTSW 17 55,917,423 (GRCm39) missense possibly damaging 0.94
R8415:Vmn2r118 UTSW 17 55,915,057 (GRCm39) missense probably benign 0.08
R8428:Vmn2r118 UTSW 17 55,915,642 (GRCm39) missense probably benign 0.33
R8917:Vmn2r118 UTSW 17 55,917,216 (GRCm39) missense possibly damaging 0.82
R8993:Vmn2r118 UTSW 17 55,917,835 (GRCm39) missense possibly damaging 0.72
R9038:Vmn2r118 UTSW 17 55,918,649 (GRCm39) missense probably damaging 1.00
R9155:Vmn2r118 UTSW 17 55,917,207 (GRCm39) missense probably null 0.83
R9603:Vmn2r118 UTSW 17 55,899,837 (GRCm39) missense probably damaging 1.00
R9742:Vmn2r118 UTSW 17 55,918,009 (GRCm39) missense probably damaging 0.98
R9792:Vmn2r118 UTSW 17 55,899,496 (GRCm39) missense probably damaging 0.99
R9793:Vmn2r118 UTSW 17 55,899,496 (GRCm39) missense probably damaging 0.99
R9795:Vmn2r118 UTSW 17 55,899,496 (GRCm39) missense probably damaging 0.99
X0022:Vmn2r118 UTSW 17 55,900,218 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r118 UTSW 17 55,917,655 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAACTGGCAGAATATTGTGAAAC -3'
(R):5'- TGCATTCTTGGAAAACATGCAG -3'

Sequencing Primer
(F):5'- GAACAAATTGAATTTAGTGCAATTGC -3'
(R):5'- GGAGATGTAGTGATCATTAATCAGC -3'
Posted On 2022-11-14