Incidental Mutation 'R9750:Esp15'
ID 732488
Institutional Source Beutler Lab
Gene Symbol Esp15
Ensembl Gene ENSMUSG00000095104
Gene Name exocrine gland secreted peptide 15
Synonyms Gm9041
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.252) question?
Stock # R9750 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 39951848-39956558 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 39955603 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 57 (M57V)
Ref Sequence ENSEMBL: ENSMUSP00000137292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178929]
AlphaFold A8R0U8
Predicted Effect probably benign
Transcript: ENSMUST00000178929
AA Change: M57V

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000137292
Gene: ENSMUSG00000095104
AA Change: M57V

DomainStartEndE-ValueType
Pfam:ESP 24 71 9.4e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.2%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 G T 11: 50,494,333 (GRCm39) V136L probably benign Het
Adamtsl3 G T 7: 82,244,589 (GRCm39) L1348F probably benign Het
Amotl1 T A 9: 14,504,102 (GRCm39) T369S probably benign Het
Anapc2 T G 2: 25,174,982 (GRCm39) V700G possibly damaging Het
Aox3 C T 1: 58,215,648 (GRCm39) Q1027* probably null Het
Ap5m1 A G 14: 49,317,756 (GRCm39) T338A probably benign Het
Carf T A 1: 60,171,158 (GRCm39) Y240* probably null Het
Ccl21a G A 4: 42,773,875 (GRCm39) A15V probably benign Het
Dcst1 A T 3: 89,261,462 (GRCm39) I429N probably damaging Het
Esco1 A G 18: 10,594,510 (GRCm39) S259P probably benign Het
Fat3 A G 9: 15,915,157 (GRCm39) I1597T probably benign Het
Fbxo38 T C 18: 62,674,061 (GRCm39) S7G probably benign Het
Gm11562 G A 11: 99,510,856 (GRCm39) P115S unknown Het
Hectd4 A T 5: 121,448,744 (GRCm39) Y364F probably benign Het
Kansl1l G C 1: 66,817,150 (GRCm39) I403M probably benign Het
Kmt2a T C 9: 44,747,499 (GRCm39) H1505R unknown Het
Krt79 T G 15: 101,839,196 (GRCm39) E424D probably benign Het
Lpgat1 T A 1: 191,510,587 (GRCm39) F391I probably benign Het
Ltbr G A 6: 125,284,348 (GRCm39) R365W probably damaging Het
Mon1a T A 9: 107,778,778 (GRCm39) V334E probably damaging Het
Ngef G A 1: 87,431,010 (GRCm39) P269L probably damaging Het
Nup210l A T 3: 90,117,659 (GRCm39) probably null Het
Obscn G A 11: 59,024,682 (GRCm39) R453W probably benign Het
Or1d2 A G 11: 74,255,858 (GRCm39) D121G possibly damaging Het
Pdzd8 A G 19: 59,289,684 (GRCm39) V572A probably benign Het
Pgr T C 9: 8,901,918 (GRCm39) S484P possibly damaging Het
Pygl G T 12: 70,245,303 (GRCm39) S473R possibly damaging Het
Samd1 T C 8: 84,725,989 (GRCm39) V410A probably damaging Het
Serpina3j T G 12: 104,280,942 (GRCm39) H38Q probably benign Het
Shprh A G 10: 11,040,204 (GRCm39) Y559C probably damaging Het
Skint5 T A 4: 113,727,866 (GRCm39) D426V unknown Het
Slc25a21 T C 12: 56,785,382 (GRCm39) K158R probably benign Het
Smc1b A T 15: 85,016,106 (GRCm39) N11K probably damaging Het
St18 T C 1: 6,873,216 (GRCm39) V317A probably benign Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,278,612 (GRCm39) probably benign Het
Tcap A G 11: 98,275,228 (GRCm39) T121A probably benign Het
Tgs1 C A 4: 3,585,869 (GRCm39) Q249K probably damaging Het
Tiam1 A T 16: 89,695,394 (GRCm39) L21Q probably damaging Het
Tmem131l G A 3: 83,831,358 (GRCm39) A858V probably damaging Het
Trpm3 G A 19: 22,903,495 (GRCm39) R927H probably benign Het
Wdfy3 T A 5: 102,077,960 (GRCm39) H870L probably benign Het
Zfp518a T A 19: 40,903,889 (GRCm39) C1273S possibly damaging Het
Zfp960 A T 17: 17,307,898 (GRCm39) H204L probably damaging Het
Other mutations in Esp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0972:Esp15 UTSW 17 39,953,557 (GRCm39) missense possibly damaging 0.89
R5387:Esp15 UTSW 17 39,955,468 (GRCm39) splice site probably null
R5528:Esp15 UTSW 17 39,955,640 (GRCm39) missense probably benign
R5576:Esp15 UTSW 17 39,953,564 (GRCm39) missense probably damaging 0.98
R7699:Esp15 UTSW 17 39,955,624 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- ATGGCGGTCTAGCATTTGTC -3'
(R):5'- GTCAAATGAGTTTCGAATTGGTGAGC -3'

Sequencing Primer
(F):5'- GCATTTGTCTTGAATTTACAGCC -3'
(R):5'- TCGAATTGGTGAGCAAAATTTTG -3'
Posted On 2022-11-14