Incidental Mutation 'R9751:Or4c119'
ID 732499
Institutional Source Beutler Lab
Gene Symbol Or4c119
Ensembl Gene ENSMUSG00000075099
Gene Name olfactory receptor family 4 subfamily C member 119
Synonyms Olfr1224, GA_x6K02T2Q125-50635980-50635046, MOR233-15
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R9751 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 88986585-88987517 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 88986782 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 246 (V246M)
Ref Sequence ENSEMBL: ENSMUSP00000148938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099792] [ENSMUST00000099793] [ENSMUST00000216833] [ENSMUST00000216976] [ENSMUST00000217342]
AlphaFold A3KGY4
Predicted Effect possibly damaging
Transcript: ENSMUST00000099792
AA Change: V246M

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097380
Gene: ENSMUSG00000075099
AA Change: V246M

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.1e-48 PFAM
Pfam:7tm_1 39 287 9.9e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000099793
AA Change: V246M

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097381
Gene: ENSMUSG00000075099
AA Change: V246M

DomainStartEndE-ValueType
Pfam:7tm_1 39 286 2e-26 PFAM
Pfam:7tm_4 138 283 5.6e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216833
AA Change: V246M

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216976
AA Change: V246M

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000217342
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,881,126 (GRCm39) N514D probably benign Het
Adgre1 G A 17: 57,757,101 (GRCm39) R786H probably null Het
Ankrd7 G A 6: 18,868,024 (GRCm39) V97I probably damaging Het
Bltp1 A G 3: 37,065,889 (GRCm39) I54M Het
Bmper C T 9: 23,318,009 (GRCm39) P543S possibly damaging Het
Brwd1 A T 16: 95,795,015 (GRCm39) M2233K possibly damaging Het
C1s2 G T 6: 124,602,553 (GRCm39) P553T probably damaging Het
Cachd1 G A 4: 100,823,438 (GRCm39) V497I possibly damaging Het
Cacng4 A G 11: 107,626,019 (GRCm39) S191P probably damaging Het
Cd109 C A 9: 78,605,442 (GRCm39) T1015K probably damaging Het
Clstn2 A G 9: 97,339,703 (GRCm39) L756P probably damaging Het
Crybg3 A T 16: 59,377,887 (GRCm39) D1122E possibly damaging Het
Csf2 A T 11: 54,140,420 (GRCm39) L6* probably null Het
Csnk1g2 T A 10: 80,473,745 (GRCm39) Y71N possibly damaging Het
Dlg2 C A 7: 90,564,731 (GRCm39) H116N probably benign Het
Dnah14 C T 1: 181,619,610 (GRCm39) S3978L probably damaging Het
Dpp8 C T 9: 64,960,453 (GRCm39) T328I probably null Het
Dync2i1 T A 12: 116,205,403 (GRCm39) probably null Het
Dysf T C 6: 84,163,450 (GRCm39) V1625A probably damaging Het
Efcab3 G A 11: 104,783,911 (GRCm39) G2754E probably benign Het
Egf C A 3: 129,548,538 (GRCm39) V26F probably damaging Het
Eif1ad19 T C 12: 87,740,526 (GRCm39) N11S possibly damaging Het
Fam20a T A 11: 109,565,992 (GRCm39) Y414F probably damaging Het
Fsip2 T C 2: 82,818,241 (GRCm39) I4658T probably benign Het
Hycc1 C T 5: 24,196,748 (GRCm39) E47K probably benign Het
Igflr1 A T 7: 30,266,653 (GRCm39) Q167L possibly damaging Het
Krt79 T G 15: 101,839,196 (GRCm39) E424D probably benign Het
Map3k6 A G 4: 132,979,168 (GRCm39) probably null Het
Mcpt4 A G 14: 56,297,511 (GRCm39) I215T probably damaging Het
Med13 T C 11: 86,189,984 (GRCm39) Y975C probably damaging Het
Meioc T A 11: 102,566,419 (GRCm39) Y678* probably null Het
Myof T C 19: 37,924,818 (GRCm39) T1190A probably benign Het
Nap1l4 A C 7: 143,088,132 (GRCm39) probably benign Het
Ncapg T C 5: 45,851,195 (GRCm39) V796A probably damaging Het
Or4c10b C T 2: 89,711,956 (GRCm39) T262I probably benign Het
Or5d39 T A 2: 87,979,614 (GRCm39) I250L probably benign Het
Or5d40 T A 2: 88,015,260 (GRCm39) V13E possibly damaging Het
Or5p68 T C 7: 107,945,645 (GRCm39) Y181C probably benign Het
Paxbp1 A G 16: 90,824,188 (GRCm39) S515P probably benign Het
Pip4p1 A G 14: 51,165,436 (GRCm39) V257A probably benign Het
Plce1 C T 19: 38,717,414 (GRCm39) S1401F probably damaging Het
Rptor A G 11: 119,777,964 (GRCm39) K1043E probably benign Het
Rtn4rl2 T G 2: 84,711,039 (GRCm39) N75T probably damaging Het
Slc35f4 A G 14: 49,536,291 (GRCm39) I448T possibly damaging Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,278,612 (GRCm39) probably benign Het
Tas2r115 A G 6: 132,714,918 (GRCm39) I11T possibly damaging Het
Tbc1d5 A G 17: 51,181,680 (GRCm39) V351A possibly damaging Het
Trim43b A T 9: 88,971,570 (GRCm39) D195E probably benign Het
Trim65 C A 11: 116,021,564 (GRCm39) A90S probably benign Het
Trip11 C T 12: 101,850,765 (GRCm39) V1100I possibly damaging Het
Tyrp1 A G 4: 80,759,012 (GRCm39) E295G probably null Het
Ube2g2 G A 10: 77,480,307 (GRCm39) V138I probably benign Het
Other mutations in Or4c119
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Or4c119 APN 2 88,987,261 (GRCm39) missense probably benign 0.01
IGL02561:Or4c119 APN 2 88,987,485 (GRCm39) missense possibly damaging 0.94
R0086:Or4c119 UTSW 2 88,986,820 (GRCm39) missense probably benign 0.01
R0096:Or4c119 UTSW 2 88,986,640 (GRCm39) missense probably benign 0.03
R0096:Or4c119 UTSW 2 88,986,640 (GRCm39) missense probably benign 0.03
R0783:Or4c119 UTSW 2 88,987,235 (GRCm39) missense probably benign 0.30
R1920:Or4c119 UTSW 2 88,986,925 (GRCm39) missense probably benign 0.44
R1921:Or4c119 UTSW 2 88,986,925 (GRCm39) missense probably benign 0.44
R2033:Or4c119 UTSW 2 88,987,498 (GRCm39) missense probably damaging 0.96
R3500:Or4c119 UTSW 2 88,987,403 (GRCm39) missense probably damaging 1.00
R5044:Or4c119 UTSW 2 88,987,283 (GRCm39) nonsense probably null
R5140:Or4c119 UTSW 2 88,987,451 (GRCm39) missense probably benign 0.12
R5253:Or4c119 UTSW 2 88,986,801 (GRCm39) nonsense probably null
R6338:Or4c119 UTSW 2 88,986,715 (GRCm39) missense probably damaging 1.00
R6431:Or4c119 UTSW 2 88,987,505 (GRCm39) missense probably damaging 1.00
R6904:Or4c119 UTSW 2 88,987,157 (GRCm39) missense possibly damaging 0.57
R7259:Or4c119 UTSW 2 88,986,854 (GRCm39) missense probably benign 0.03
R7820:Or4c119 UTSW 2 88,986,592 (GRCm39) missense probably benign 0.08
R9026:Or4c119 UTSW 2 88,986,988 (GRCm39) missense probably benign 0.22
R9076:Or4c119 UTSW 2 88,986,719 (GRCm39) missense possibly damaging 0.95
R9266:Or4c119 UTSW 2 88,986,854 (GRCm39) missense possibly damaging 0.70
R9378:Or4c119 UTSW 2 88,987,399 (GRCm39) missense probably damaging 1.00
R9580:Or4c119 UTSW 2 88,987,465 (GRCm39) missense probably benign 0.20
Z1176:Or4c119 UTSW 2 88,986,811 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGATCGGAAATTTACATCAAG -3'
(R):5'- GCTTGCCTGCACCAATACAC -3'

Sequencing Primer
(F):5'- ACAAATTGAGCCATTTCCCTGG -3'
(R):5'- GCCTGCACCAATACACACATTTTTG -3'
Posted On 2022-11-14