Incidental Mutation 'R9751:Olfr1257'
ID 732500
Institutional Source Beutler Lab
Gene Symbol Olfr1257
Ensembl Gene ENSMUSG00000049057
Gene Name olfactory receptor 1257
Synonyms MOR232-1, GA_x6K02T2Q125-51319458-51320387
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R9751 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 89878437-89883026 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 89881612 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 262 (T262I)
Ref Sequence ENSEMBL: ENSMUSP00000107144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060795] [ENSMUST00000111519]
AlphaFold Q8VGP0
Predicted Effect probably benign
Transcript: ENSMUST00000060795
AA Change: T262I

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000056439
Gene: ENSMUSG00000049057
AA Change: T262I

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 2.6e-31 PFAM
Pfam:7tm_4 137 278 8e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111519
AA Change: T262I

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000107144
Gene: ENSMUSG00000049057
AA Change: T262I

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.5e-49 PFAM
Pfam:7tm_1 39 285 3.9e-18 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,011,740 I54M Het
Abca4 A G 3: 122,087,477 N514D probably benign Het
Adgre1 G A 17: 57,450,101 R786H probably null Het
Ankrd7 G A 6: 18,868,025 V97I probably damaging Het
Bmper C T 9: 23,406,713 P543S possibly damaging Het
Brwd1 A T 16: 95,993,815 M2233K possibly damaging Het
C1s2 G T 6: 124,625,594 P553T probably damaging Het
Cachd1 G A 4: 100,966,241 V497I possibly damaging Het
Cacng4 A G 11: 107,735,193 S191P probably damaging Het
Cd109 C A 9: 78,698,160 T1015K probably damaging Het
Clstn2 A G 9: 97,457,650 L756P probably damaging Het
Crybg3 A T 16: 59,557,524 D1122E possibly damaging Het
Csf2 A T 11: 54,249,594 L6* probably null Het
Csnk1g2 T A 10: 80,637,911 Y71N possibly damaging Het
Dlg2 C A 7: 90,915,523 H116N probably benign Het
Dnah14 C T 1: 181,792,045 S3978L probably damaging Het
Dpp8 C T 9: 65,053,171 T328I probably null Het
Dysf T C 6: 84,186,468 V1625A probably damaging Het
Egf C A 3: 129,754,889 V26F probably damaging Het
Fam126a C T 5: 23,991,750 E47K probably benign Het
Fam20a T A 11: 109,675,166 Y414F probably damaging Het
Fsip2 T C 2: 82,987,897 I4658T probably benign Het
Gm11639 G A 11: 104,893,085 G2754E probably benign Het
Gm21319 T C 12: 87,773,756 N11S possibly damaging Het
Igflr1 A T 7: 30,567,228 Q167L possibly damaging Het
Krt79 T G 15: 101,930,761 E424D probably benign Het
Map3k6 A G 4: 133,251,857 probably null Het
Mcpt4 A G 14: 56,060,054 I215T probably damaging Het
Med13 T C 11: 86,299,158 Y975C probably damaging Het
Meioc T A 11: 102,675,593 Y678* probably null Het
Myof T C 19: 37,936,370 T1190A probably benign Het
Nap1l4 A C 7: 143,534,395 probably benign Het
Ncapg T C 5: 45,693,853 V796A probably damaging Het
Olfr1167 T A 2: 88,149,270 I250L probably benign Het
Olfr1168 T A 2: 88,184,916 V13E possibly damaging Het
Olfr1224-ps1 C T 2: 89,156,438 V246M possibly damaging Het
Olfr493 T C 7: 108,346,438 Y181C probably benign Het
Paxbp1 A G 16: 91,027,300 S515P probably benign Het
Plce1 C T 19: 38,728,970 S1401F probably damaging Het
Rptor A G 11: 119,887,138 K1043E probably benign Het
Rtn4rl2 T G 2: 84,880,695 N75T probably damaging Het
Slc35f4 A G 14: 49,298,834 I448T possibly damaging Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,301,649 probably benign Het
Tas2r115 A G 6: 132,737,955 I11T possibly damaging Het
Tbc1d5 A G 17: 50,874,652 V351A possibly damaging Het
Tmem55b A G 14: 50,927,979 V257A probably benign Het
Trim43b A T 9: 89,089,517 D195E probably benign Het
Trim65 C A 11: 116,130,738 A90S probably benign Het
Trip11 C T 12: 101,884,506 V1100I possibly damaging Het
Tyrp1 A G 4: 80,840,775 E295G probably null Het
Ube2g2 G A 10: 77,644,473 V138I probably benign Het
Wdr60 T A 12: 116,241,783 probably null Het
Other mutations in Olfr1257
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01600:Olfr1257 APN 2 89881662 missense probably benign 0.02
IGL01641:Olfr1257 APN 2 89881608 missense probably benign 0.01
IGL01668:Olfr1257 APN 2 89881099 missense probably benign 0.01
IGL01901:Olfr1257 APN 2 89881482 missense probably damaging 1.00
IGL02401:Olfr1257 APN 2 89881453 missense probably damaging 1.00
IGL02472:Olfr1257 APN 2 89881411 missense probably benign 0.44
IGL02631:Olfr1257 APN 2 89881255 missense possibly damaging 0.95
PIT4354001:Olfr1257 UTSW 2 89881508 missense probably benign 0.04
R0552:Olfr1257 UTSW 2 89880891 nonsense probably null
R0616:Olfr1257 UTSW 2 89881591 missense probably benign 0.07
R0943:Olfr1257 UTSW 2 89880961 missense probably benign 0.11
R1146:Olfr1257 UTSW 2 89881206 missense probably damaging 1.00
R1146:Olfr1257 UTSW 2 89881206 missense probably damaging 1.00
R1314:Olfr1257 UTSW 2 89880877 missense probably benign 0.35
R1641:Olfr1257 UTSW 2 89881401 missense probably benign 0.07
R1763:Olfr1257 UTSW 2 89881129 missense probably damaging 0.99
R1836:Olfr1257 UTSW 2 89881285 missense probably damaging 1.00
R2125:Olfr1257 UTSW 2 89881638 missense probably benign
R4322:Olfr1257 UTSW 2 89881734 missense probably benign 0.07
R4897:Olfr1257 UTSW 2 89881132 missense probably benign 0.39
R5446:Olfr1257 UTSW 2 89881549 missense probably damaging 1.00
R5456:Olfr1257 UTSW 2 89881258 missense probably damaging 0.97
R6415:Olfr1257 UTSW 2 89880862 missense probably damaging 1.00
R6905:Olfr1257 UTSW 2 89881708 missense probably benign 0.05
R7170:Olfr1257 UTSW 2 89880841 missense probably benign 0.12
R7170:Olfr1257 UTSW 2 89881053 missense possibly damaging 0.70
R7411:Olfr1257 UTSW 2 89881261 missense probably damaging 0.98
R8171:Olfr1257 UTSW 2 89881065 missense probably benign 0.05
R8490:Olfr1257 UTSW 2 89881167 missense probably damaging 1.00
R9176:Olfr1257 UTSW 2 89881171 missense probably benign 0.05
R9204:Olfr1257 UTSW 2 89881138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGGAATCTTTGTTGCAGCC -3'
(R):5'- AAAGTGCCTGTCCAATTTTCTG -3'

Sequencing Primer
(F):5'- CCAACAGTGGTTTTATTTGTCTGC -3'
(R):5'- AGTGCCTGTCCAATTTTCTGATTCAG -3'
Posted On 2022-11-14