Incidental Mutation 'R9751:Cachd1'
ID 732505
Institutional Source Beutler Lab
Gene Symbol Cachd1
Ensembl Gene ENSMUSG00000028532
Gene Name cache domain containing 1
Synonyms Vwcd1, 1190007F10Rik, B430218L07Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.274) question?
Stock # R9751 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 100633870-100861741 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 100823438 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 497 (V497I)
Ref Sequence ENSEMBL: ENSMUSP00000030257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030257] [ENSMUST00000097955]
AlphaFold Q6PDJ1
Predicted Effect possibly damaging
Transcript: ENSMUST00000030257
AA Change: V497I

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030257
Gene: ENSMUSG00000028532
AA Change: V497I

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Pfam:VWA_N 103 218 9.4e-22 PFAM
VWA 240 438 2.8e-1 SMART
Pfam:Cache_1 467 543 2.4e-12 PFAM
Pfam:Cache_1 786 871 1.5e-7 PFAM
low complexity region 981 996 N/A INTRINSIC
transmembrane domain 1109 1131 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
low complexity region 1240 1246 N/A INTRINSIC
low complexity region 1260 1274 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097955
AA Change: V497I

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095568
Gene: ENSMUSG00000028532
AA Change: V497I

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Pfam:VWA_N 103 218 6.7e-32 PFAM
VWA 240 438 2.8e-1 SMART
Pfam:Cache_1 467 543 1.7e-12 PFAM
low complexity region 801 818 N/A INTRINSIC
low complexity region 981 996 N/A INTRINSIC
transmembrane domain 1109 1131 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,881,126 (GRCm39) N514D probably benign Het
Adgre1 G A 17: 57,757,101 (GRCm39) R786H probably null Het
Ankrd7 G A 6: 18,868,024 (GRCm39) V97I probably damaging Het
Bltp1 A G 3: 37,065,889 (GRCm39) I54M Het
Bmper C T 9: 23,318,009 (GRCm39) P543S possibly damaging Het
Brwd1 A T 16: 95,795,015 (GRCm39) M2233K possibly damaging Het
C1s2 G T 6: 124,602,553 (GRCm39) P553T probably damaging Het
Cacng4 A G 11: 107,626,019 (GRCm39) S191P probably damaging Het
Cd109 C A 9: 78,605,442 (GRCm39) T1015K probably damaging Het
Clstn2 A G 9: 97,339,703 (GRCm39) L756P probably damaging Het
Crybg3 A T 16: 59,377,887 (GRCm39) D1122E possibly damaging Het
Csf2 A T 11: 54,140,420 (GRCm39) L6* probably null Het
Csnk1g2 T A 10: 80,473,745 (GRCm39) Y71N possibly damaging Het
Dlg2 C A 7: 90,564,731 (GRCm39) H116N probably benign Het
Dnah14 C T 1: 181,619,610 (GRCm39) S3978L probably damaging Het
Dpp8 C T 9: 64,960,453 (GRCm39) T328I probably null Het
Dync2i1 T A 12: 116,205,403 (GRCm39) probably null Het
Dysf T C 6: 84,163,450 (GRCm39) V1625A probably damaging Het
Efcab3 G A 11: 104,783,911 (GRCm39) G2754E probably benign Het
Egf C A 3: 129,548,538 (GRCm39) V26F probably damaging Het
Eif1ad19 T C 12: 87,740,526 (GRCm39) N11S possibly damaging Het
Fam20a T A 11: 109,565,992 (GRCm39) Y414F probably damaging Het
Fsip2 T C 2: 82,818,241 (GRCm39) I4658T probably benign Het
Hycc1 C T 5: 24,196,748 (GRCm39) E47K probably benign Het
Igflr1 A T 7: 30,266,653 (GRCm39) Q167L possibly damaging Het
Krt79 T G 15: 101,839,196 (GRCm39) E424D probably benign Het
Map3k6 A G 4: 132,979,168 (GRCm39) probably null Het
Mcpt4 A G 14: 56,297,511 (GRCm39) I215T probably damaging Het
Med13 T C 11: 86,189,984 (GRCm39) Y975C probably damaging Het
Meioc T A 11: 102,566,419 (GRCm39) Y678* probably null Het
Myof T C 19: 37,924,818 (GRCm39) T1190A probably benign Het
Nap1l4 A C 7: 143,088,132 (GRCm39) probably benign Het
Ncapg T C 5: 45,851,195 (GRCm39) V796A probably damaging Het
Or4c10b C T 2: 89,711,956 (GRCm39) T262I probably benign Het
Or4c119 C T 2: 88,986,782 (GRCm39) V246M possibly damaging Het
Or5d39 T A 2: 87,979,614 (GRCm39) I250L probably benign Het
Or5d40 T A 2: 88,015,260 (GRCm39) V13E possibly damaging Het
Or5p68 T C 7: 107,945,645 (GRCm39) Y181C probably benign Het
Paxbp1 A G 16: 90,824,188 (GRCm39) S515P probably benign Het
Pip4p1 A G 14: 51,165,436 (GRCm39) V257A probably benign Het
Plce1 C T 19: 38,717,414 (GRCm39) S1401F probably damaging Het
Rptor A G 11: 119,777,964 (GRCm39) K1043E probably benign Het
Rtn4rl2 T G 2: 84,711,039 (GRCm39) N75T probably damaging Het
Slc35f4 A G 14: 49,536,291 (GRCm39) I448T possibly damaging Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,278,612 (GRCm39) probably benign Het
Tas2r115 A G 6: 132,714,918 (GRCm39) I11T possibly damaging Het
Tbc1d5 A G 17: 51,181,680 (GRCm39) V351A possibly damaging Het
Trim43b A T 9: 88,971,570 (GRCm39) D195E probably benign Het
Trim65 C A 11: 116,021,564 (GRCm39) A90S probably benign Het
Trip11 C T 12: 101,850,765 (GRCm39) V1100I possibly damaging Het
Tyrp1 A G 4: 80,759,012 (GRCm39) E295G probably null Het
Ube2g2 G A 10: 77,480,307 (GRCm39) V138I probably benign Het
Other mutations in Cachd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Cachd1 APN 4 100,824,163 (GRCm39) missense probably benign 0.05
IGL01531:Cachd1 APN 4 100,810,231 (GRCm39) missense probably benign 0.02
IGL01705:Cachd1 APN 4 100,840,736 (GRCm39) missense possibly damaging 0.46
IGL01843:Cachd1 APN 4 100,850,069 (GRCm39) missense probably damaging 0.98
IGL01938:Cachd1 APN 4 100,831,325 (GRCm39) missense possibly damaging 0.59
IGL02268:Cachd1 APN 4 100,809,294 (GRCm39) missense possibly damaging 0.75
IGL02934:Cachd1 APN 4 100,825,295 (GRCm39) missense probably damaging 0.98
IGL03019:Cachd1 APN 4 100,809,282 (GRCm39) missense probably damaging 0.98
IGL03084:Cachd1 APN 4 100,860,285 (GRCm39) missense probably damaging 0.99
R0366:Cachd1 UTSW 4 100,851,934 (GRCm39) missense possibly damaging 0.94
R0395:Cachd1 UTSW 4 100,810,402 (GRCm39) missense probably damaging 1.00
R0520:Cachd1 UTSW 4 100,754,900 (GRCm39) missense probably damaging 0.99
R0578:Cachd1 UTSW 4 100,852,039 (GRCm39) splice site probably benign
R0646:Cachd1 UTSW 4 100,845,418 (GRCm39) missense probably damaging 1.00
R0689:Cachd1 UTSW 4 100,832,073 (GRCm39) missense probably damaging 1.00
R0962:Cachd1 UTSW 4 100,840,498 (GRCm39) splice site probably benign
R1156:Cachd1 UTSW 4 100,845,816 (GRCm39) missense probably damaging 1.00
R1157:Cachd1 UTSW 4 100,832,037 (GRCm39) missense possibly damaging 0.77
R1314:Cachd1 UTSW 4 100,832,114 (GRCm39) missense probably damaging 1.00
R1482:Cachd1 UTSW 4 100,845,795 (GRCm39) missense possibly damaging 0.94
R1632:Cachd1 UTSW 4 100,824,169 (GRCm39) missense probably benign 0.02
R1774:Cachd1 UTSW 4 100,821,632 (GRCm39) missense probably damaging 1.00
R1774:Cachd1 UTSW 4 100,824,240 (GRCm39) missense probably benign 0.02
R1845:Cachd1 UTSW 4 100,634,555 (GRCm39) missense probably benign 0.01
R1869:Cachd1 UTSW 4 100,840,587 (GRCm39) missense probably damaging 1.00
R1912:Cachd1 UTSW 4 100,810,366 (GRCm39) missense probably damaging 0.99
R2069:Cachd1 UTSW 4 100,848,041 (GRCm39) missense probably damaging 1.00
R2082:Cachd1 UTSW 4 100,860,155 (GRCm39) missense probably damaging 1.00
R2267:Cachd1 UTSW 4 100,806,266 (GRCm39) splice site probably benign
R2517:Cachd1 UTSW 4 100,838,079 (GRCm39) splice site probably null
R2896:Cachd1 UTSW 4 100,828,100 (GRCm39) missense probably damaging 1.00
R3729:Cachd1 UTSW 4 100,832,077 (GRCm39) nonsense probably null
R3818:Cachd1 UTSW 4 100,848,062 (GRCm39) missense probably damaging 1.00
R3979:Cachd1 UTSW 4 100,828,085 (GRCm39) missense probably damaging 1.00
R4647:Cachd1 UTSW 4 100,810,327 (GRCm39) nonsense probably null
R4791:Cachd1 UTSW 4 100,775,282 (GRCm39) missense probably damaging 1.00
R5133:Cachd1 UTSW 4 100,851,935 (GRCm39) missense probably damaging 0.98
R5147:Cachd1 UTSW 4 100,821,688 (GRCm39) missense probably damaging 1.00
R5187:Cachd1 UTSW 4 100,823,397 (GRCm39) missense possibly damaging 0.94
R5322:Cachd1 UTSW 4 100,809,319 (GRCm39) missense probably damaging 0.98
R5335:Cachd1 UTSW 4 100,825,282 (GRCm39) missense possibly damaging 0.88
R5390:Cachd1 UTSW 4 100,838,203 (GRCm39) missense probably damaging 1.00
R5573:Cachd1 UTSW 4 100,831,276 (GRCm39) missense probably damaging 0.99
R5578:Cachd1 UTSW 4 100,722,203 (GRCm39) missense probably benign 0.31
R5905:Cachd1 UTSW 4 100,840,753 (GRCm39) missense probably damaging 0.99
R6003:Cachd1 UTSW 4 100,809,216 (GRCm39) missense possibly damaging 0.79
R6028:Cachd1 UTSW 4 100,840,753 (GRCm39) missense probably damaging 0.99
R6185:Cachd1 UTSW 4 100,838,228 (GRCm39) nonsense probably null
R6367:Cachd1 UTSW 4 100,860,167 (GRCm39) missense probably damaging 1.00
R6492:Cachd1 UTSW 4 100,809,315 (GRCm39) missense possibly damaging 0.89
R6591:Cachd1 UTSW 4 100,846,683 (GRCm39) missense probably benign
R6691:Cachd1 UTSW 4 100,846,683 (GRCm39) missense probably benign
R7129:Cachd1 UTSW 4 100,775,263 (GRCm39) missense probably null 0.99
R7187:Cachd1 UTSW 4 100,833,552 (GRCm39) missense possibly damaging 0.95
R7387:Cachd1 UTSW 4 100,634,375 (GRCm39) missense unknown
R7833:Cachd1 UTSW 4 100,832,012 (GRCm39) missense probably benign 0.09
R7835:Cachd1 UTSW 4 100,831,350 (GRCm39) splice site probably null
R7838:Cachd1 UTSW 4 100,824,211 (GRCm39) missense possibly damaging 0.71
R7867:Cachd1 UTSW 4 100,845,759 (GRCm39) missense probably damaging 0.97
R7882:Cachd1 UTSW 4 100,824,244 (GRCm39) missense probably benign 0.29
R7941:Cachd1 UTSW 4 100,845,370 (GRCm39) missense probably damaging 1.00
R7978:Cachd1 UTSW 4 100,832,060 (GRCm39) missense probably damaging 1.00
R8085:Cachd1 UTSW 4 100,845,361 (GRCm39) missense probably damaging 1.00
R8153:Cachd1 UTSW 4 100,845,835 (GRCm39) critical splice donor site probably null
R8174:Cachd1 UTSW 4 100,823,466 (GRCm39) missense probably damaging 0.99
R8219:Cachd1 UTSW 4 100,848,159 (GRCm39) missense probably benign 0.34
R8358:Cachd1 UTSW 4 100,816,668 (GRCm39) missense possibly damaging 0.94
R8376:Cachd1 UTSW 4 100,832,073 (GRCm39) missense probably damaging 0.99
R8686:Cachd1 UTSW 4 100,845,325 (GRCm39) missense probably damaging 0.99
R8747:Cachd1 UTSW 4 100,860,045 (GRCm39) intron probably benign
R8845:Cachd1 UTSW 4 100,810,343 (GRCm39) missense probably benign 0.36
R8864:Cachd1 UTSW 4 100,852,026 (GRCm39) missense probably damaging 0.99
R8869:Cachd1 UTSW 4 100,809,280 (GRCm39) missense probably benign 0.09
R8870:Cachd1 UTSW 4 100,754,978 (GRCm39) missense probably damaging 0.99
R8904:Cachd1 UTSW 4 100,810,363 (GRCm39) missense probably damaging 1.00
R8958:Cachd1 UTSW 4 100,851,283 (GRCm39) missense probably benign 0.11
R9061:Cachd1 UTSW 4 100,809,202 (GRCm39) critical splice acceptor site probably null
R9193:Cachd1 UTSW 4 100,634,339 (GRCm39) missense unknown
R9304:Cachd1 UTSW 4 100,824,179 (GRCm39) missense possibly damaging 0.81
R9358:Cachd1 UTSW 4 100,833,622 (GRCm39) missense probably damaging 0.99
R9373:Cachd1 UTSW 4 100,832,067 (GRCm39) missense possibly damaging 0.94
R9425:Cachd1 UTSW 4 100,832,057 (GRCm39) missense probably benign
R9632:Cachd1 UTSW 4 100,832,092 (GRCm39) missense probably benign 0.34
R9710:Cachd1 UTSW 4 100,832,092 (GRCm39) missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- CAAGGGCAGTGCTTAGGATCTG -3'
(R):5'- GGTCCTGGCGATGTAAGTTC -3'

Sequencing Primer
(F):5'- AGTGCTTAGGATCTGGACCAC -3'
(R):5'- CCTGGCGATGTAAGTTCTTTGAG -3'
Posted On 2022-11-14