Mutagenetix > Incidental Mutation

Incidental Mutation 'R9751:Cachd1'

732505

Institutional Source

Beutler Lab

Gene Symbol

Cachd1

Ensembl Gene

ENSMUSG00000028532

Gene Name

cache domain containing 1

Synonyms

Vwcd1, B430218L07Rik, 1190007F10Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.336) question?

Stock #

R9751 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

100776675-101029220 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 100966241 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 497 (V497I)

Ref Sequence

ENSEMBL: ENSMUSP00000030257 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030257] [ENSMUST00000097955]

AlphaFold

Q6PDJ1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030257
AA Change: V497I

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000030257
Gene: ENSMUSG00000028532
AA Change: V497I

Domain	Start	End	E-Value	Type
low complexity region	11	24	N/A	INTRINSIC
Pfam:VWA_N	103	218	9.4e-22	PFAM
VWA	240	438	2.8e-1	SMART
Pfam:Cache_1	467	543	2.4e-12	PFAM
Pfam:Cache_1	786	871	1.5e-7	PFAM
low complexity region	981	996	N/A	INTRINSIC
transmembrane domain	1109	1131	N/A	INTRINSIC
low complexity region	1159	1173	N/A	INTRINSIC
low complexity region	1240	1246	N/A	INTRINSIC
low complexity region	1260	1274	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000097955
AA Change: V497I

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000095568
Gene: ENSMUSG00000028532
AA Change: V497I

Domain	Start	End	E-Value	Type
low complexity region	11	24	N/A	INTRINSIC
Pfam:VWA_N	103	218	6.7e-32	PFAM
VWA	240	438	2.8e-1	SMART
Pfam:Cache_1	467	543	1.7e-12	PFAM
low complexity region	801	818	N/A	INTRINSIC
low complexity region	981	996	N/A	INTRINSIC
transmembrane domain	1109	1131	N/A	INTRINSIC
low complexity region	1159	1173	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.5%
20x: 99.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	G	3: 37,011,740	I54M		Het
Abca4	A	G	3: 122,087,477	N514D	probably benign	Het
Adgre1	G	A	17: 57,450,101	R786H	probably null	Het
Ankrd7	G	A	6: 18,868,025	V97I	probably damaging	Het
Bmper	C	T	9: 23,406,713	P543S	possibly damaging	Het
Brwd1	A	T	16: 95,993,815	M2233K	possibly damaging	Het
C1s2	G	T	6: 124,625,594	P553T	probably damaging	Het
Cacng4	A	G	11: 107,735,193	S191P	probably damaging	Het
Cd109	C	A	9: 78,698,160	T1015K	probably damaging	Het
Clstn2	A	G	9: 97,457,650	L756P	probably damaging	Het
Crybg3	A	T	16: 59,557,524	D1122E	possibly damaging	Het
Csf2	A	T	11: 54,249,594	L6*	probably null	Het
Csnk1g2	T	A	10: 80,637,911	Y71N	possibly damaging	Het
Dlg2	C	A	7: 90,915,523	H116N	probably benign	Het
Dnah14	C	T	1: 181,792,045	S3978L	probably damaging	Het
Dpp8	C	T	9: 65,053,171	T328I	probably null	Het
Dysf	T	C	6: 84,186,468	V1625A	probably damaging	Het
Egf	C	A	3: 129,754,889	V26F	probably damaging	Het
Fam126a	C	T	5: 23,991,750	E47K	probably benign	Het
Fam20a	T	A	11: 109,675,166	Y414F	probably damaging	Het
Fsip2	T	C	2: 82,987,897	I4658T	probably benign	Het
Gm11639	G	A	11: 104,893,085	G2754E	probably benign	Het
Gm21319	T	C	12: 87,773,756	N11S	possibly damaging	Het
Igflr1	A	T	7: 30,567,228	Q167L	possibly damaging	Het
Krt79	T	G	15: 101,930,761	E424D	probably benign	Het
Map3k6	A	G	4: 133,251,857		probably null	Het
Mcpt4	A	G	14: 56,060,054	I215T	probably damaging	Het
Med13	T	C	11: 86,299,158	Y975C	probably damaging	Het
Meioc	T	A	11: 102,675,593	Y678*	probably null	Het
Myof	T	C	19: 37,936,370	T1190A	probably benign	Het
Nap1l4	A	C	7: 143,534,395		probably benign	Het
Ncapg	T	C	5: 45,693,853	V796A	probably damaging	Het
Olfr1167	T	A	2: 88,149,270	I250L	probably benign	Het
Olfr1168	T	A	2: 88,184,916	V13E	possibly damaging	Het
Olfr1224-ps1	C	T	2: 89,156,438	V246M	possibly damaging	Het
Olfr1257	C	T	2: 89,881,612	T262I	probably benign	Het
Olfr493	T	C	7: 108,346,438	Y181C	probably benign	Het
Paxbp1	A	G	16: 91,027,300	S515P	probably benign	Het
Plce1	C	T	19: 38,728,970	S1401F	probably damaging	Het
Rptor	A	G	11: 119,887,138	K1043E	probably benign	Het
Rtn4rl2	T	G	2: 84,880,695	N75T	probably damaging	Het
Slc35f4	A	G	14: 49,298,834	I448T	possibly damaging	Het
Styk1	CTCTTCATGATTTTCTT	CTCTT	6: 131,301,649		probably benign	Het
Tas2r115	A	G	6: 132,737,955	I11T	possibly damaging	Het
Tbc1d5	A	G	17: 50,874,652	V351A	possibly damaging	Het
Tmem55b	A	G	14: 50,927,979	V257A	probably benign	Het
Trim43b	A	T	9: 89,089,517	D195E	probably benign	Het
Trim65	C	A	11: 116,130,738	A90S	probably benign	Het
Trip11	C	T	12: 101,884,506	V1100I	possibly damaging	Het
Tyrp1	A	G	4: 80,840,775	E295G	probably null	Het
Ube2g2	G	A	10: 77,644,473	V138I	probably benign	Het
Wdr60	T	A	12: 116,241,783		probably null	Het

Other mutations in Cachd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Cachd1	APN	4	100966966	missense	probably benign	0.05
IGL01531:Cachd1	APN	4	100953034	missense	probably benign	0.02
IGL01705:Cachd1	APN	4	100983539	missense	possibly damaging	0.46
IGL01843:Cachd1	APN	4	100992872	missense	probably damaging	0.98
IGL01938:Cachd1	APN	4	100974128	missense	possibly damaging	0.59
IGL02268:Cachd1	APN	4	100952097	missense	possibly damaging	0.75
IGL02934:Cachd1	APN	4	100968098	missense	probably damaging	0.98
IGL03019:Cachd1	APN	4	100952085	missense	probably damaging	0.98
IGL03084:Cachd1	APN	4	101003088	missense	probably damaging	0.99
R0366:Cachd1	UTSW	4	100994737	missense	possibly damaging	0.94
R0395:Cachd1	UTSW	4	100953205	missense	probably damaging	1.00
R0520:Cachd1	UTSW	4	100897703	missense	probably damaging	0.99
R0578:Cachd1	UTSW	4	100994842	splice site	probably benign
R0646:Cachd1	UTSW	4	100988221	missense	probably damaging	1.00
R0689:Cachd1	UTSW	4	100974876	missense	probably damaging	1.00
R0962:Cachd1	UTSW	4	100983301	splice site	probably benign
R1156:Cachd1	UTSW	4	100988619	missense	probably damaging	1.00
R1157:Cachd1	UTSW	4	100974840	missense	possibly damaging	0.77
R1314:Cachd1	UTSW	4	100974917	missense	probably damaging	1.00
R1482:Cachd1	UTSW	4	100988598	missense	possibly damaging	0.94
R1632:Cachd1	UTSW	4	100966972	missense	probably benign	0.02
R1774:Cachd1	UTSW	4	100964435	missense	probably damaging	1.00
R1774:Cachd1	UTSW	4	100967043	missense	probably benign	0.02
R1845:Cachd1	UTSW	4	100777358	missense	probably benign	0.01
R1869:Cachd1	UTSW	4	100983390	missense	probably damaging	1.00
R1912:Cachd1	UTSW	4	100953169	missense	probably damaging	0.99
R2069:Cachd1	UTSW	4	100990844	missense	probably damaging	1.00
R2082:Cachd1	UTSW	4	101002958	missense	probably damaging	1.00
R2267:Cachd1	UTSW	4	100949069	splice site	probably benign
R2517:Cachd1	UTSW	4	100980882	splice site	probably null
R2896:Cachd1	UTSW	4	100970903	missense	probably damaging	1.00
R3729:Cachd1	UTSW	4	100974880	nonsense	probably null
R3818:Cachd1	UTSW	4	100990865	missense	probably damaging	1.00
R3979:Cachd1	UTSW	4	100970888	missense	probably damaging	1.00
R4647:Cachd1	UTSW	4	100953130	nonsense	probably null
R4791:Cachd1	UTSW	4	100918085	missense	probably damaging	1.00
R5133:Cachd1	UTSW	4	100994738	missense	probably damaging	0.98
R5147:Cachd1	UTSW	4	100964491	missense	probably damaging	1.00
R5187:Cachd1	UTSW	4	100966200	missense	possibly damaging	0.94
R5322:Cachd1	UTSW	4	100952122	missense	probably damaging	0.98
R5335:Cachd1	UTSW	4	100968085	missense	possibly damaging	0.88
R5390:Cachd1	UTSW	4	100981006	missense	probably damaging	1.00
R5573:Cachd1	UTSW	4	100974079	missense	probably damaging	0.99
R5578:Cachd1	UTSW	4	100865006	missense	probably benign	0.31
R5905:Cachd1	UTSW	4	100983556	missense	probably damaging	0.99
R6003:Cachd1	UTSW	4	100952019	missense	possibly damaging	0.79
R6028:Cachd1	UTSW	4	100983556	missense	probably damaging	0.99
R6185:Cachd1	UTSW	4	100981031	nonsense	probably null
R6367:Cachd1	UTSW	4	101002970	missense	probably damaging	1.00
R6492:Cachd1	UTSW	4	100952118	missense	possibly damaging	0.89
R6591:Cachd1	UTSW	4	100989486	missense	probably benign
R6691:Cachd1	UTSW	4	100989486	missense	probably benign
R7129:Cachd1	UTSW	4	100918066	missense	probably null	0.99
R7187:Cachd1	UTSW	4	100976355	missense	possibly damaging	0.95
R7387:Cachd1	UTSW	4	100777178	missense	unknown
R7833:Cachd1	UTSW	4	100974815	missense	probably benign	0.09
R7835:Cachd1	UTSW	4	100974153	splice site	probably null
R7838:Cachd1	UTSW	4	100967014	missense	possibly damaging	0.71
R7867:Cachd1	UTSW	4	100988562	missense	probably damaging	0.97
R7882:Cachd1	UTSW	4	100967047	missense	probably benign	0.29
R7941:Cachd1	UTSW	4	100988173	missense	probably damaging	1.00
R7978:Cachd1	UTSW	4	100974863	missense	probably damaging	1.00
R8085:Cachd1	UTSW	4	100988164	missense	probably damaging	1.00
R8153:Cachd1	UTSW	4	100988638	critical splice donor site	probably null
R8174:Cachd1	UTSW	4	100966269	missense	probably damaging	0.99
R8219:Cachd1	UTSW	4	100990962	missense	probably benign	0.34
R8358:Cachd1	UTSW	4	100959471	missense	possibly damaging	0.94
R8376:Cachd1	UTSW	4	100974876	missense	probably damaging	0.99
R8686:Cachd1	UTSW	4	100988128	missense	probably damaging	0.99
R8747:Cachd1	UTSW	4	101002848	intron	probably benign
R8845:Cachd1	UTSW	4	100953146	missense	probably benign	0.36
R8864:Cachd1	UTSW	4	100994829	missense	probably damaging	0.99
R8869:Cachd1	UTSW	4	100952083	missense	probably benign	0.09
R8870:Cachd1	UTSW	4	100897781	missense	probably damaging	0.99
R8904:Cachd1	UTSW	4	100953166	missense	probably damaging	1.00
R8958:Cachd1	UTSW	4	100994086	missense	probably benign	0.11
R9061:Cachd1	UTSW	4	100952005	critical splice acceptor site	probably null
R9193:Cachd1	UTSW	4	100777142	missense	unknown
R9304:Cachd1	UTSW	4	100966982	missense	possibly damaging	0.81
R9358:Cachd1	UTSW	4	100976425	missense	probably damaging	0.99
R9373:Cachd1	UTSW	4	100974870	missense	possibly damaging	0.94
R9425:Cachd1	UTSW	4	100974860	missense	probably benign
R9632:Cachd1	UTSW	4	100974895	missense	probably benign	0.34
R9710:Cachd1	UTSW	4	100974895	missense	probably benign	0.34

Predicted Primers

PCR Primer
(F):5'- CAAGGGCAGTGCTTAGGATCTG -3'
(R):5'- GGTCCTGGCGATGTAAGTTC -3'

Sequencing Primer
(F):5'- AGTGCTTAGGATCTGGACCAC -3'
(R):5'- CCTGGCGATGTAAGTTCTTTGAG -3'

Posted On

2022-11-14