Mutagenetix > Incidental Mutation

Incidental Mutation 'R9751:Map3k6'

732506

Institutional Source

Beutler Lab

Gene Symbol

Map3k6

Ensembl Gene

ENSMUSG00000028862

Gene Name

mitogen-activated protein kinase kinase kinase 6

Synonyms

Ask2, MAPKKK6, MEKK6

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.393) question?

Stock #

R9751 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

133240818-133252929 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to G at 133251857 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000030677 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030674] [ENSMUST00000030677] [ENSMUST00000105908]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000030674

SMART Domains

Protein: ENSMUSP00000030674
Gene: ENSMUSG00000028860

Domain	Start	End	E-Value	Type
PDB:3BC1\|F	40	92	2e-9	PDB
low complexity region	169	183	N/A	INTRINSIC
low complexity region	235	262	N/A	INTRINSIC
C2	288	389	2.36e-17	SMART
C2	429	532	6.96e-6	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000030677

SMART Domains

Protein: ENSMUSP00000030677
Gene: ENSMUSG00000028862

Domain	Start	End	E-Value	Type
low complexity region	98	109	N/A	INTRINSIC
Pfam:DUF4071	130	508	2.3e-150	PFAM
S_TKc	649	907	3.49e-87	SMART
low complexity region	925	940	N/A	INTRINSIC
low complexity region	947	960	N/A	INTRINSIC
low complexity region	975	990	N/A	INTRINSIC
low complexity region	1130	1146	N/A	INTRINSIC
coiled coil region	1164	1195	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105908

SMART Domains

Protein: ENSMUSP00000101528
Gene: ENSMUSG00000028860

Domain	Start	End	E-Value	Type
PDB:3BC1\|F	40	92	2e-9	PDB
low complexity region	157	171	N/A	INTRINSIC
low complexity region	223	250	N/A	INTRINSIC
C2	276	359	3.15e-4	SMART
C2	364	467	6.96e-6	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.5%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase that forms a component of protein kinase-mediated signal transduction cascades. The encoded kinase participates in the regulation of vascular endothelial growth factor (VEGF) expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous and heterozygous null mice display an increased incidence of chemically induced skin tumors and homozygous mice also show resistance to induced apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	G	3: 37,011,740	I54M		Het
Abca4	A	G	3: 122,087,477	N514D	probably benign	Het
Adgre1	G	A	17: 57,450,101	R786H	probably null	Het
Ankrd7	G	A	6: 18,868,025	V97I	probably damaging	Het
Bmper	C	T	9: 23,406,713	P543S	possibly damaging	Het
Brwd1	A	T	16: 95,993,815	M2233K	possibly damaging	Het
C1s2	G	T	6: 124,625,594	P553T	probably damaging	Het
Cachd1	G	A	4: 100,966,241	V497I	possibly damaging	Het
Cacng4	A	G	11: 107,735,193	S191P	probably damaging	Het
Cd109	C	A	9: 78,698,160	T1015K	probably damaging	Het
Clstn2	A	G	9: 97,457,650	L756P	probably damaging	Het
Crybg3	A	T	16: 59,557,524	D1122E	possibly damaging	Het
Csf2	A	T	11: 54,249,594	L6*	probably null	Het
Csnk1g2	T	A	10: 80,637,911	Y71N	possibly damaging	Het
Dlg2	C	A	7: 90,915,523	H116N	probably benign	Het
Dnah14	C	T	1: 181,792,045	S3978L	probably damaging	Het
Dpp8	C	T	9: 65,053,171	T328I	probably null	Het
Dysf	T	C	6: 84,186,468	V1625A	probably damaging	Het
Egf	C	A	3: 129,754,889	V26F	probably damaging	Het
Fam126a	C	T	5: 23,991,750	E47K	probably benign	Het
Fam20a	T	A	11: 109,675,166	Y414F	probably damaging	Het
Fsip2	T	C	2: 82,987,897	I4658T	probably benign	Het
Gm11639	G	A	11: 104,893,085	G2754E	probably benign	Het
Gm21319	T	C	12: 87,773,756	N11S	possibly damaging	Het
Igflr1	A	T	7: 30,567,228	Q167L	possibly damaging	Het
Krt79	T	G	15: 101,930,761	E424D	probably benign	Het
Mcpt4	A	G	14: 56,060,054	I215T	probably damaging	Het
Med13	T	C	11: 86,299,158	Y975C	probably damaging	Het
Meioc	T	A	11: 102,675,593	Y678*	probably null	Het
Myof	T	C	19: 37,936,370	T1190A	probably benign	Het
Nap1l4	A	C	7: 143,534,395		probably benign	Het
Ncapg	T	C	5: 45,693,853	V796A	probably damaging	Het
Olfr1167	T	A	2: 88,149,270	I250L	probably benign	Het
Olfr1168	T	A	2: 88,184,916	V13E	possibly damaging	Het
Olfr1224-ps1	C	T	2: 89,156,438	V246M	possibly damaging	Het
Olfr1257	C	T	2: 89,881,612	T262I	probably benign	Het
Olfr493	T	C	7: 108,346,438	Y181C	probably benign	Het
Paxbp1	A	G	16: 91,027,300	S515P	probably benign	Het
Plce1	C	T	19: 38,728,970	S1401F	probably damaging	Het
Rptor	A	G	11: 119,887,138	K1043E	probably benign	Het
Rtn4rl2	T	G	2: 84,880,695	N75T	probably damaging	Het
Slc35f4	A	G	14: 49,298,834	I448T	possibly damaging	Het
Styk1	CTCTTCATGATTTTCTT	CTCTT	6: 131,301,649		probably benign	Het
Tas2r115	A	G	6: 132,737,955	I11T	possibly damaging	Het
Tbc1d5	A	G	17: 50,874,652	V351A	possibly damaging	Het
Tmem55b	A	G	14: 50,927,979	V257A	probably benign	Het
Trim43b	A	T	9: 89,089,517	D195E	probably benign	Het
Trim65	C	A	11: 116,130,738	A90S	probably benign	Het
Trip11	C	T	12: 101,884,506	V1100I	possibly damaging	Het
Tyrp1	A	G	4: 80,840,775	E295G	probably null	Het
Ube2g2	G	A	10: 77,644,473	V138I	probably benign	Het
Wdr60	T	A	12: 116,241,783		probably null	Het

Other mutations in Map3k6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Map3k6	APN	4	133243044	splice site	probably benign
IGL01060:Map3k6	APN	4	133247302	splice site	probably null
IGL01116:Map3k6	APN	4	133247128	missense	probably damaging	0.98
IGL01341:Map3k6	APN	4	133248060	missense	possibly damaging	0.67
IGL02383:Map3k6	APN	4	133246621	splice site	probably null
IGL03090:Map3k6	APN	4	133243366	missense	probably benign	0.05
IGL03096:Map3k6	APN	4	133251345	nonsense	probably null
IGL03149:Map3k6	APN	4	133249688	missense	probably damaging	1.00
R0110:Map3k6	UTSW	4	133243794	missense	probably damaging	1.00
R0142:Map3k6	UTSW	4	133250946	missense	probably benign
R0189:Map3k6	UTSW	4	133246941	missense	possibly damaging	0.46
R0368:Map3k6	UTSW	4	133252659	missense	probably benign	0.23
R0417:Map3k6	UTSW	4	133248082	nonsense	probably null
R0595:Map3k6	UTSW	4	133241263	missense	probably damaging	0.98
R0597:Map3k6	UTSW	4	133245552	missense	possibly damaging	0.46
R0699:Map3k6	UTSW	4	133248126	missense	probably damaging	1.00
R1099:Map3k6	UTSW	4	133247128	missense	probably damaging	1.00
R1113:Map3k6	UTSW	4	133245815	missense	probably damaging	1.00
R1308:Map3k6	UTSW	4	133245815	missense	probably damaging	1.00
R1607:Map3k6	UTSW	4	133252473	missense	probably damaging	1.00
R2217:Map3k6	UTSW	4	133246672	missense	possibly damaging	0.46
R3734:Map3k6	UTSW	4	133248396	missense	possibly damaging	0.79
R3735:Map3k6	UTSW	4	133246372	missense	probably benign	0.21
R3743:Map3k6	UTSW	4	133245073	missense	probably benign	0.26
R4244:Map3k6	UTSW	4	133251947	missense	possibly damaging	0.65
R4245:Map3k6	UTSW	4	133251947	missense	possibly damaging	0.65
R4465:Map3k6	UTSW	4	133246333	missense	possibly damaging	0.66
R4482:Map3k6	UTSW	4	133243399	missense	probably benign	0.00
R4827:Map3k6	UTSW	4	133248849	missense	possibly damaging	0.92
R5092:Map3k6	UTSW	4	133251743	missense	probably benign	0.00
R5110:Map3k6	UTSW	4	133247548	intron	probably benign
R5258:Map3k6	UTSW	4	133247642	missense	possibly damaging	0.81
R5369:Map3k6	UTSW	4	133247681	missense	probably damaging	0.99
R5642:Map3k6	UTSW	4	133245544	missense	probably damaging	0.99
R5648:Map3k6	UTSW	4	133243335	missense	probably benign	0.25
R6102:Map3k6	UTSW	4	133247131	critical splice donor site	probably null
R6144:Map3k6	UTSW	4	133245675	missense	probably damaging	1.00
R6476:Map3k6	UTSW	4	133250086	missense	probably damaging	0.98
R6511:Map3k6	UTSW	4	133248078	missense	probably damaging	0.98
R6522:Map3k6	UTSW	4	133250024	missense	possibly damaging	0.65
R6706:Map3k6	UTSW	4	133250939	nonsense	probably null
R6874:Map3k6	UTSW	4	133250656	missense	probably benign	0.02
R7069:Map3k6	UTSW	4	133251712	missense	probably benign	0.01
R7216:Map3k6	UTSW	4	133246900	missense	probably damaging	0.99
R7417:Map3k6	UTSW	4	133248396	missense	probably benign	0.43
R7538:Map3k6	UTSW	4	133251927	missense	probably benign
R7569:Map3k6	UTSW	4	133250077	missense	probably benign	0.04
R8003:Map3k6	UTSW	4	133248882	missense	probably benign	0.05
R8407:Map3k6	UTSW	4	133247593	missense	possibly damaging	0.95
R8817:Map3k6	UTSW	4	133246760	missense	probably benign	0.00
R8939:Map3k6	UTSW	4	133252643	unclassified	probably benign
R9285:Map3k6	UTSW	4	133245559	missense	probably damaging	1.00
R9308:Map3k6	UTSW	4	133243411	missense	probably damaging	1.00
R9400:Map3k6	UTSW	4	133241156	missense	probably damaging	1.00
R9401:Map3k6	UTSW	4	133241156	missense	probably damaging	1.00
R9573:Map3k6	UTSW	4	133252463	missense	probably damaging	0.99
R9677:Map3k6	UTSW	4	133241116	missense	probably benign	0.04
R9682:Map3k6	UTSW	4	133248108	missense	possibly damaging	0.61
R9745:Map3k6	UTSW	4	133252472	missense	probably damaging	1.00
Z1088:Map3k6	UTSW	4	133245066	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGTCTTACCGAGGTCAGAAGAG -3'
(R):5'- GCAAAGGTGTTCTCTGTGGC -3'

Sequencing Primer
(F):5'- CTTACCGAGGTCAGAAGAGTCGAG -3'
(R):5'- CAAAGGTGTTCTCTGTGGCCTTAC -3'

Posted On

2022-11-14