Incidental Mutation 'R9751:Tas2r115'
ID 732513
Institutional Source Beutler Lab
Gene Symbol Tas2r115
Ensembl Gene ENSMUSG00000071149
Gene Name taste receptor, type 2, member 115
Synonyms T2R15, mt2r49, Tas2r15, mGR15
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R9751 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 132714017-132714949 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 132714918 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 11 (I11T)
Ref Sequence ENSEMBL: ENSMUSP00000093043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095394]
AlphaFold Q7M719
Predicted Effect possibly damaging
Transcript: ENSMUST00000095394
AA Change: I11T

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000093043
Gene: ENSMUSG00000071149
AA Change: I11T

DomainStartEndE-ValueType
Pfam:TAS2R 1 299 2.2e-84 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,881,126 (GRCm39) N514D probably benign Het
Adgre1 G A 17: 57,757,101 (GRCm39) R786H probably null Het
Ankrd7 G A 6: 18,868,024 (GRCm39) V97I probably damaging Het
Bltp1 A G 3: 37,065,889 (GRCm39) I54M Het
Bmper C T 9: 23,318,009 (GRCm39) P543S possibly damaging Het
Brwd1 A T 16: 95,795,015 (GRCm39) M2233K possibly damaging Het
C1s2 G T 6: 124,602,553 (GRCm39) P553T probably damaging Het
Cachd1 G A 4: 100,823,438 (GRCm39) V497I possibly damaging Het
Cacng4 A G 11: 107,626,019 (GRCm39) S191P probably damaging Het
Cd109 C A 9: 78,605,442 (GRCm39) T1015K probably damaging Het
Clstn2 A G 9: 97,339,703 (GRCm39) L756P probably damaging Het
Crybg3 A T 16: 59,377,887 (GRCm39) D1122E possibly damaging Het
Csf2 A T 11: 54,140,420 (GRCm39) L6* probably null Het
Csnk1g2 T A 10: 80,473,745 (GRCm39) Y71N possibly damaging Het
Dlg2 C A 7: 90,564,731 (GRCm39) H116N probably benign Het
Dnah14 C T 1: 181,619,610 (GRCm39) S3978L probably damaging Het
Dpp8 C T 9: 64,960,453 (GRCm39) T328I probably null Het
Dync2i1 T A 12: 116,205,403 (GRCm39) probably null Het
Dysf T C 6: 84,163,450 (GRCm39) V1625A probably damaging Het
Efcab3 G A 11: 104,783,911 (GRCm39) G2754E probably benign Het
Egf C A 3: 129,548,538 (GRCm39) V26F probably damaging Het
Eif1ad19 T C 12: 87,740,526 (GRCm39) N11S possibly damaging Het
Fam20a T A 11: 109,565,992 (GRCm39) Y414F probably damaging Het
Fsip2 T C 2: 82,818,241 (GRCm39) I4658T probably benign Het
Hycc1 C T 5: 24,196,748 (GRCm39) E47K probably benign Het
Igflr1 A T 7: 30,266,653 (GRCm39) Q167L possibly damaging Het
Krt79 T G 15: 101,839,196 (GRCm39) E424D probably benign Het
Map3k6 A G 4: 132,979,168 (GRCm39) probably null Het
Mcpt4 A G 14: 56,297,511 (GRCm39) I215T probably damaging Het
Med13 T C 11: 86,189,984 (GRCm39) Y975C probably damaging Het
Meioc T A 11: 102,566,419 (GRCm39) Y678* probably null Het
Myof T C 19: 37,924,818 (GRCm39) T1190A probably benign Het
Nap1l4 A C 7: 143,088,132 (GRCm39) probably benign Het
Ncapg T C 5: 45,851,195 (GRCm39) V796A probably damaging Het
Or4c10b C T 2: 89,711,956 (GRCm39) T262I probably benign Het
Or4c119 C T 2: 88,986,782 (GRCm39) V246M possibly damaging Het
Or5d39 T A 2: 87,979,614 (GRCm39) I250L probably benign Het
Or5d40 T A 2: 88,015,260 (GRCm39) V13E possibly damaging Het
Or5p68 T C 7: 107,945,645 (GRCm39) Y181C probably benign Het
Paxbp1 A G 16: 90,824,188 (GRCm39) S515P probably benign Het
Pip4p1 A G 14: 51,165,436 (GRCm39) V257A probably benign Het
Plce1 C T 19: 38,717,414 (GRCm39) S1401F probably damaging Het
Rptor A G 11: 119,777,964 (GRCm39) K1043E probably benign Het
Rtn4rl2 T G 2: 84,711,039 (GRCm39) N75T probably damaging Het
Slc35f4 A G 14: 49,536,291 (GRCm39) I448T possibly damaging Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,278,612 (GRCm39) probably benign Het
Tbc1d5 A G 17: 51,181,680 (GRCm39) V351A possibly damaging Het
Trim43b A T 9: 88,971,570 (GRCm39) D195E probably benign Het
Trim65 C A 11: 116,021,564 (GRCm39) A90S probably benign Het
Trip11 C T 12: 101,850,765 (GRCm39) V1100I possibly damaging Het
Tyrp1 A G 4: 80,759,012 (GRCm39) E295G probably null Het
Ube2g2 G A 10: 77,480,307 (GRCm39) V138I probably benign Het
Other mutations in Tas2r115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Tas2r115 APN 6 132,714,741 (GRCm39) missense probably benign 0.11
IGL01285:Tas2r115 APN 6 132,714,641 (GRCm39) missense probably damaging 1.00
IGL01516:Tas2r115 APN 6 132,714,576 (GRCm39) missense probably damaging 0.98
IGL01637:Tas2r115 APN 6 132,714,592 (GRCm39) missense probably damaging 0.99
IGL02041:Tas2r115 APN 6 132,714,430 (GRCm39) missense probably benign 0.13
IGL02178:Tas2r115 APN 6 132,714,271 (GRCm39) missense probably benign 0.11
R0467:Tas2r115 UTSW 6 132,714,682 (GRCm39) missense probably benign 0.02
R0553:Tas2r115 UTSW 6 132,714,922 (GRCm39) missense probably benign 0.18
R1425:Tas2r115 UTSW 6 132,714,442 (GRCm39) missense probably benign 0.02
R1770:Tas2r115 UTSW 6 132,714,934 (GRCm39) missense probably damaging 1.00
R2120:Tas2r115 UTSW 6 132,714,470 (GRCm39) missense possibly damaging 0.51
R2136:Tas2r115 UTSW 6 132,714,309 (GRCm39) missense probably damaging 0.99
R2141:Tas2r115 UTSW 6 132,714,321 (GRCm39) missense probably benign 0.43
R2142:Tas2r115 UTSW 6 132,714,321 (GRCm39) missense probably benign 0.43
R4479:Tas2r115 UTSW 6 132,714,495 (GRCm39) missense probably damaging 0.98
R4687:Tas2r115 UTSW 6 132,714,247 (GRCm39) missense possibly damaging 0.80
R4948:Tas2r115 UTSW 6 132,714,124 (GRCm39) missense probably damaging 1.00
R5097:Tas2r115 UTSW 6 132,714,216 (GRCm39) missense probably damaging 1.00
R5856:Tas2r115 UTSW 6 132,714,501 (GRCm39) missense possibly damaging 0.86
R6927:Tas2r115 UTSW 6 132,714,895 (GRCm39) missense probably damaging 1.00
R7473:Tas2r115 UTSW 6 132,714,214 (GRCm39) missense probably damaging 1.00
R7688:Tas2r115 UTSW 6 132,714,643 (GRCm39) missense probably damaging 1.00
R8415:Tas2r115 UTSW 6 132,714,798 (GRCm39) missense probably damaging 1.00
R8495:Tas2r115 UTSW 6 132,714,887 (GRCm39) missense probably damaging 1.00
R9032:Tas2r115 UTSW 6 132,714,327 (GRCm39) missense probably benign 0.37
R9085:Tas2r115 UTSW 6 132,714,327 (GRCm39) missense probably benign 0.37
R9318:Tas2r115 UTSW 6 132,714,472 (GRCm39) missense probably benign 0.01
R9665:Tas2r115 UTSW 6 132,714,390 (GRCm39) missense probably benign 0.31
Z1088:Tas2r115 UTSW 6 132,714,044 (GRCm39) nonsense probably null
Z1176:Tas2r115 UTSW 6 132,714,819 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGCAGTCTGAATCAGTCTTAATG -3'
(R):5'- CCTGGAAGAATTTCAGCCAAGC -3'

Sequencing Primer
(F):5'- TCTAGTCATCAGTAATGGGGATTG -3'
(R):5'- GCTGGAGGTAAAAATCCAAAATTCTG -3'
Posted On 2022-11-14