Incidental Mutation 'R9751:Cd109'
ID 732520
Institutional Source Beutler Lab
Gene Symbol Cd109
Ensembl Gene ENSMUSG00000046186
Gene Name CD109 antigen
Synonyms Gov platelet alloantigens, 9930012E15Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9751 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 78615546-78716253 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 78698160 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 1015 (T1015K)
Ref Sequence ENSEMBL: ENSMUSP00000091330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093812]
AlphaFold Q8R422
Predicted Effect probably damaging
Transcript: ENSMUST00000093812
AA Change: T1015K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091330
Gene: ENSMUSG00000046186
AA Change: T1015K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:A2M_N 129 220 1.5e-16 PFAM
A2M_N_2 470 601 8.89e-32 SMART
A2M 695 786 2.07e-32 SMART
Pfam:Thiol-ester_cl 912 941 2.6e-20 PFAM
Pfam:A2M_comp 961 1197 1.9e-65 PFAM
low complexity region 1265 1275 N/A INTRINSIC
A2M_recep 1311 1395 2.06e-27 SMART
low complexity region 1422 1437 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl phosphatidylinositol (GPI)-linked glycoprotein that localizes to the surface of platelets, activated T-cells, and endothelial cells. The protein binds to and negatively regulates signalling by transforming growth factor beta (TGF-beta). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a null mutation display epidermal hyperplasia and thickening, sebaceous gland hyperplasia and transient impairment of hair growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,011,740 I54M Het
Abca4 A G 3: 122,087,477 N514D probably benign Het
Adgre1 G A 17: 57,450,101 R786H probably null Het
Ankrd7 G A 6: 18,868,025 V97I probably damaging Het
Bmper C T 9: 23,406,713 P543S possibly damaging Het
Brwd1 A T 16: 95,993,815 M2233K possibly damaging Het
C1s2 G T 6: 124,625,594 P553T probably damaging Het
Cachd1 G A 4: 100,966,241 V497I possibly damaging Het
Cacng4 A G 11: 107,735,193 S191P probably damaging Het
Clstn2 A G 9: 97,457,650 L756P probably damaging Het
Crybg3 A T 16: 59,557,524 D1122E possibly damaging Het
Csf2 A T 11: 54,249,594 L6* probably null Het
Csnk1g2 T A 10: 80,637,911 Y71N possibly damaging Het
Dlg2 C A 7: 90,915,523 H116N probably benign Het
Dnah14 C T 1: 181,792,045 S3978L probably damaging Het
Dpp8 C T 9: 65,053,171 T328I probably null Het
Dysf T C 6: 84,186,468 V1625A probably damaging Het
Egf C A 3: 129,754,889 V26F probably damaging Het
Fam126a C T 5: 23,991,750 E47K probably benign Het
Fam20a T A 11: 109,675,166 Y414F probably damaging Het
Fsip2 T C 2: 82,987,897 I4658T probably benign Het
Gm11639 G A 11: 104,893,085 G2754E probably benign Het
Gm21319 T C 12: 87,773,756 N11S possibly damaging Het
Igflr1 A T 7: 30,567,228 Q167L possibly damaging Het
Krt79 T G 15: 101,930,761 E424D probably benign Het
Map3k6 A G 4: 133,251,857 probably null Het
Mcpt4 A G 14: 56,060,054 I215T probably damaging Het
Med13 T C 11: 86,299,158 Y975C probably damaging Het
Meioc T A 11: 102,675,593 Y678* probably null Het
Myof T C 19: 37,936,370 T1190A probably benign Het
Nap1l4 A C 7: 143,534,395 probably benign Het
Ncapg T C 5: 45,693,853 V796A probably damaging Het
Olfr1167 T A 2: 88,149,270 I250L probably benign Het
Olfr1168 T A 2: 88,184,916 V13E possibly damaging Het
Olfr1224-ps1 C T 2: 89,156,438 V246M possibly damaging Het
Olfr1257 C T 2: 89,881,612 T262I probably benign Het
Olfr493 T C 7: 108,346,438 Y181C probably benign Het
Paxbp1 A G 16: 91,027,300 S515P probably benign Het
Plce1 C T 19: 38,728,970 S1401F probably damaging Het
Rptor A G 11: 119,887,138 K1043E probably benign Het
Rtn4rl2 T G 2: 84,880,695 N75T probably damaging Het
Slc35f4 A G 14: 49,298,834 I448T possibly damaging Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,301,649 probably benign Het
Tas2r115 A G 6: 132,737,955 I11T possibly damaging Het
Tbc1d5 A G 17: 50,874,652 V351A possibly damaging Het
Tmem55b A G 14: 50,927,979 V257A probably benign Het
Trim43b A T 9: 89,089,517 D195E probably benign Het
Trim65 C A 11: 116,130,738 A90S probably benign Het
Trip11 C T 12: 101,884,506 V1100I possibly damaging Het
Tyrp1 A G 4: 80,840,775 E295G probably null Het
Ube2g2 G A 10: 77,644,473 V138I probably benign Het
Wdr60 T A 12: 116,241,783 probably null Het
Other mutations in Cd109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cd109 APN 9 78616969 missense probably damaging 1.00
IGL00465:Cd109 APN 9 78660934 nonsense probably null
IGL00667:Cd109 APN 9 78684877 missense probably damaging 0.99
IGL01432:Cd109 APN 9 78698123 missense probably benign
IGL01795:Cd109 APN 9 78661765 splice site probably benign
IGL02343:Cd109 APN 9 78688955 splice site probably benign
IGL02450:Cd109 APN 9 78695850 missense possibly damaging 0.83
IGL02699:Cd109 APN 9 78671989 splice site probably benign
IGL02738:Cd109 APN 9 78691299 missense probably damaging 1.00
IGL02797:Cd109 APN 9 78661713 missense probably damaging 0.96
IGL03160:Cd109 APN 9 78661056 splice site probably null
IGL03349:Cd109 APN 9 78636485 missense probably benign 0.34
FR4589:Cd109 UTSW 9 78712529 critical splice acceptor site probably benign
R0048:Cd109 UTSW 9 78680021 missense possibly damaging 0.50
R0060:Cd109 UTSW 9 78703107 missense probably damaging 1.00
R0060:Cd109 UTSW 9 78703107 missense probably damaging 1.00
R0158:Cd109 UTSW 9 78688932 missense possibly damaging 0.49
R0415:Cd109 UTSW 9 78712615 missense probably benign 0.13
R0659:Cd109 UTSW 9 78680170 splice site probably benign
R0709:Cd109 UTSW 9 78671978 missense possibly damaging 0.93
R0840:Cd109 UTSW 9 78664330 missense probably benign 0.04
R0909:Cd109 UTSW 9 78636473 missense probably benign 0.01
R0945:Cd109 UTSW 9 78688941 missense possibly damaging 0.51
R1344:Cd109 UTSW 9 78672550 critical splice acceptor site probably null
R1471:Cd109 UTSW 9 78654587 missense probably damaging 1.00
R1484:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R1570:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R1688:Cd109 UTSW 9 78705091 missense probably benign 0.17
R1773:Cd109 UTSW 9 78703724 missense probably benign 0.21
R1813:Cd109 UTSW 9 78617005 missense probably benign 0.04
R2004:Cd109 UTSW 9 78703762 missense probably benign 0.00
R2083:Cd109 UTSW 9 78667293 missense probably damaging 1.00
R2483:Cd109 UTSW 9 78667357 missense probably damaging 1.00
R2857:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2858:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2859:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2911:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2912:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2914:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R2927:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3623:Cd109 UTSW 9 78667357 missense probably damaging 1.00
R3713:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3760:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3762:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3771:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3772:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3773:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3916:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R3917:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4117:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4260:Cd109 UTSW 9 78636463 missense possibly damaging 0.67
R4387:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4389:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4526:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4527:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4528:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4700:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4708:Cd109 UTSW 9 78672589 missense probably benign 0.00
R4723:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4750:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4751:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4754:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4755:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4773:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R4984:Cd109 UTSW 9 78634677 critical splice donor site probably null
R5259:Cd109 UTSW 9 78710152 missense probably benign 0.30
R5353:Cd109 UTSW 9 78710239 missense probably damaging 1.00
R5440:Cd109 UTSW 9 78680164 critical splice donor site probably null
R5559:Cd109 UTSW 9 78660968 missense probably benign 0.01
R5701:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R5995:Cd109 UTSW 9 78700279 missense probably benign 0.01
R5997:Cd109 UTSW 9 78705062 missense possibly damaging 0.93
R6103:Cd109 UTSW 9 78698314 splice site probably null
R6174:Cd109 UTSW 9 78665546 critical splice donor site probably null
R6410:Cd109 UTSW 9 78657516 missense probably benign 0.01
R6529:Cd109 UTSW 9 78712625 missense probably damaging 1.00
R6655:Cd109 UTSW 9 78684938 missense probably benign 0.44
R6704:Cd109 UTSW 9 78680075 missense probably benign 0.01
R6772:Cd109 UTSW 9 78680810 missense possibly damaging 0.55
R6817:Cd109 UTSW 9 78714955 missense probably benign 0.01
R6903:Cd109 UTSW 9 78636603 missense probably damaging 0.97
R7294:Cd109 UTSW 9 78712635 missense probably damaging 0.97
R7432:Cd109 UTSW 9 78714943 missense possibly damaging 0.85
R7566:Cd109 UTSW 9 78680837 missense probably damaging 1.00
R7767:Cd109 UTSW 9 78710159 missense probably damaging 1.00
R7986:Cd109 UTSW 9 78688766 missense possibly damaging 0.95
R8017:Cd109 UTSW 9 78707546 missense possibly damaging 0.81
R8019:Cd109 UTSW 9 78707546 missense possibly damaging 0.81
R8050:Cd109 UTSW 9 78664351 missense probably benign 0.28
R8225:Cd109 UTSW 9 78661690 missense probably damaging 0.99
R8269:Cd109 UTSW 9 78665682 missense probably benign 0.06
R8479:Cd109 UTSW 9 78667346 nonsense probably null
R8493:Cd109 UTSW 9 78657519 missense probably benign 0.41
R8781:Cd109 UTSW 9 78636647 missense probably damaging 1.00
R8977:Cd109 UTSW 9 78707528 missense probably benign 0.36
R9051:Cd109 UTSW 9 78712500 critical splice acceptor site probably benign
R9051:Cd109 UTSW 9 78712531 critical splice acceptor site probably benign
R9228:Cd109 UTSW 9 78669760 missense possibly damaging 0.93
R9366:Cd109 UTSW 9 78714993 missense probably benign 0.11
R9430:Cd109 UTSW 9 78667416 critical splice donor site probably null
R9572:Cd109 UTSW 9 78660306 missense probably benign 0.16
R9691:Cd109 UTSW 9 78703792 missense possibly damaging 0.94
R9736:Cd109 UTSW 9 78712636 missense probably damaging 1.00
R9749:Cd109 UTSW 9 78684884 missense probably damaging 1.00
R9752:Cd109 UTSW 9 78707552 missense probably benign 0.00
R9789:Cd109 UTSW 9 78634662 missense possibly damaging 0.90
R9797:Cd109 UTSW 9 78671935 missense probably benign 0.04
RF002:Cd109 UTSW 9 78712523 critical splice acceptor site probably benign
RF002:Cd109 UTSW 9 78712528 critical splice acceptor site probably benign
RF003:Cd109 UTSW 9 78712531 critical splice acceptor site probably benign
RF011:Cd109 UTSW 9 78712528 critical splice acceptor site probably benign
RF013:Cd109 UTSW 9 78712531 critical splice acceptor site probably benign
RF047:Cd109 UTSW 9 78712527 critical splice acceptor site probably benign
RF060:Cd109 UTSW 9 78712525 critical splice acceptor site probably benign
Z1177:Cd109 UTSW 9 78691313 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTCATTCCCAAATAAGAACCAGGTC -3'
(R):5'- GTGTGCCCAAATGCAAAGGG -3'

Sequencing Primer
(F):5'- GAACCAGGTCCACCAGCTAAG -3'
(R):5'- GACACATATTTGACTCAGCAAGATC -3'
Posted On 2022-11-14