Mutagenetix > Incidental Mutation

Incidental Mutation 'R9751:Clstn2'

732522

Institutional Source

Beutler Lab

Gene Symbol

Clstn2

Ensembl Gene

ENSMUSG00000032452

Gene Name

calsyntenin 2

Synonyms

Cst-2, CSTN2, CS2, 2900042C18Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9751 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

97444395-98033181 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 97457650 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 756 (L756P)

Ref Sequence

ENSEMBL: ENSMUSP00000035027 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035027] [ENSMUST00000162295]

AlphaFold

Q9ER65

Predicted Effect

probably damaging
Transcript: ENSMUST00000035027
AA Change: L756P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000035027
Gene: ENSMUSG00000032452
AA Change: L756P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CA	67	160	2e-10	SMART
CA	183	261	1.18e-3	SMART
SCOP:d1a8d_1	358	538	5e-21	SMART
Blast:LamG	380	529	3e-41	BLAST
transmembrane domain	835	857	N/A	INTRINSIC
low complexity region	901	935	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000162295
AA Change: L756P

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000124081
Gene: ENSMUSG00000032452
AA Change: L756P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CA	67	160	2e-10	SMART
CA	183	261	1.18e-3	SMART
Pfam:Laminin_G_3	356	533	1.4e-9	PFAM
transmembrane domain	835	857	N/A	INTRINSIC
low complexity region	901	935	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.5%
20x: 99.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous KO mice display deficiency in spatial learning and memory in Morris water and Barnes maze tasks and increased locomotor activity in open field test. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	G	3: 37,011,740	I54M		Het
Abca4	A	G	3: 122,087,477	N514D	probably benign	Het
Adgre1	G	A	17: 57,450,101	R786H	probably null	Het
Ankrd7	G	A	6: 18,868,025	V97I	probably damaging	Het
Bmper	C	T	9: 23,406,713	P543S	possibly damaging	Het
Brwd1	A	T	16: 95,993,815	M2233K	possibly damaging	Het
C1s2	G	T	6: 124,625,594	P553T	probably damaging	Het
Cachd1	G	A	4: 100,966,241	V497I	possibly damaging	Het
Cacng4	A	G	11: 107,735,193	S191P	probably damaging	Het
Cd109	C	A	9: 78,698,160	T1015K	probably damaging	Het
Crybg3	A	T	16: 59,557,524	D1122E	possibly damaging	Het
Csf2	A	T	11: 54,249,594	L6*	probably null	Het
Csnk1g2	T	A	10: 80,637,911	Y71N	possibly damaging	Het
Dlg2	C	A	7: 90,915,523	H116N	probably benign	Het
Dnah14	C	T	1: 181,792,045	S3978L	probably damaging	Het
Dpp8	C	T	9: 65,053,171	T328I	probably null	Het
Dysf	T	C	6: 84,186,468	V1625A	probably damaging	Het
Egf	C	A	3: 129,754,889	V26F	probably damaging	Het
Fam126a	C	T	5: 23,991,750	E47K	probably benign	Het
Fam20a	T	A	11: 109,675,166	Y414F	probably damaging	Het
Fsip2	T	C	2: 82,987,897	I4658T	probably benign	Het
Gm11639	G	A	11: 104,893,085	G2754E	probably benign	Het
Gm21319	T	C	12: 87,773,756	N11S	possibly damaging	Het
Igflr1	A	T	7: 30,567,228	Q167L	possibly damaging	Het
Krt79	T	G	15: 101,930,761	E424D	probably benign	Het
Map3k6	A	G	4: 133,251,857		probably null	Het
Mcpt4	A	G	14: 56,060,054	I215T	probably damaging	Het
Med13	T	C	11: 86,299,158	Y975C	probably damaging	Het
Meioc	T	A	11: 102,675,593	Y678*	probably null	Het
Myof	T	C	19: 37,936,370	T1190A	probably benign	Het
Nap1l4	A	C	7: 143,534,395		probably benign	Het
Ncapg	T	C	5: 45,693,853	V796A	probably damaging	Het
Olfr1167	T	A	2: 88,149,270	I250L	probably benign	Het
Olfr1168	T	A	2: 88,184,916	V13E	possibly damaging	Het
Olfr1224-ps1	C	T	2: 89,156,438	V246M	possibly damaging	Het
Olfr1257	C	T	2: 89,881,612	T262I	probably benign	Het
Olfr493	T	C	7: 108,346,438	Y181C	probably benign	Het
Paxbp1	A	G	16: 91,027,300	S515P	probably benign	Het
Plce1	C	T	19: 38,728,970	S1401F	probably damaging	Het
Rptor	A	G	11: 119,887,138	K1043E	probably benign	Het
Rtn4rl2	T	G	2: 84,880,695	N75T	probably damaging	Het
Slc35f4	A	G	14: 49,298,834	I448T	possibly damaging	Het
Styk1	CTCTTCATGATTTTCTT	CTCTT	6: 131,301,649		probably benign	Het
Tas2r115	A	G	6: 132,737,955	I11T	possibly damaging	Het
Tbc1d5	A	G	17: 50,874,652	V351A	possibly damaging	Het
Tmem55b	A	G	14: 50,927,979	V257A	probably benign	Het
Trim43b	A	T	9: 89,089,517	D195E	probably benign	Het
Trim65	C	A	11: 116,130,738	A90S	probably benign	Het
Trip11	C	T	12: 101,884,506	V1100I	possibly damaging	Het
Tyrp1	A	G	4: 80,840,775	E295G	probably null	Het
Ube2g2	G	A	10: 77,644,473	V138I	probably benign	Het
Wdr60	T	A	12: 116,241,783		probably null	Het

Other mutations in Clstn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00562:Clstn2	APN	9	97582452	splice site	probably benign
IGL00563:Clstn2	APN	9	97582452	splice site	probably benign
IGL00733:Clstn2	APN	9	97483049	missense	probably damaging	1.00
IGL01303:Clstn2	APN	9	97483075	nonsense	probably null
IGL01935:Clstn2	APN	9	97463468	missense	probably damaging	1.00
IGL02157:Clstn2	APN	9	97541875	missense	probably benign
IGL02974:Clstn2	APN	9	97532707	missense	probably damaging	1.00
IGL03164:Clstn2	APN	9	97799409	missense	possibly damaging	0.50
IGL03298:Clstn2	APN	9	97456572	missense	probably damaging	1.00
R0653:Clstn2	UTSW	9	97458204	missense	probably damaging	1.00
R0845:Clstn2	UTSW	9	97570628	missense	probably benign	0.39
R0992:Clstn2	UTSW	9	97445712	missense	probably benign	0.00
R1105:Clstn2	UTSW	9	97583499	splice site	probably null
R1112:Clstn2	UTSW	9	97458228	missense	possibly damaging	0.92
R1264:Clstn2	UTSW	9	97457609	missense	probably benign	0.28
R1275:Clstn2	UTSW	9	97457430	missense	probably benign	0.00
R1329:Clstn2	UTSW	9	97458174	missense	probably damaging	1.00
R1396:Clstn2	UTSW	9	97461393	missense	probably benign	0.02
R1556:Clstn2	UTSW	9	97456505	missense	probably benign	0.41
R1703:Clstn2	UTSW	9	97458237	missense	possibly damaging	0.90
R1837:Clstn2	UTSW	9	97583540	missense	probably benign	0.00
R2911:Clstn2	UTSW	9	97532722	missense	probably damaging	1.00
R3434:Clstn2	UTSW	9	97454715	missense	probably benign	0.17
R3771:Clstn2	UTSW	9	97582562	missense	probably damaging	1.00
R3772:Clstn2	UTSW	9	97582562	missense	probably damaging	1.00
R3854:Clstn2	UTSW	9	97463595	nonsense	probably null
R4049:Clstn2	UTSW	9	97457560	missense	possibly damaging	0.59
R4334:Clstn2	UTSW	9	97463528	missense	probably damaging	1.00
R4705:Clstn2	UTSW	9	97463559	missense	possibly damaging	0.95
R4755:Clstn2	UTSW	9	97445673	missense	probably benign	0.01
R4884:Clstn2	UTSW	9	97799395	missense	probably damaging	1.00
R5017:Clstn2	UTSW	9	97483086	missense	probably damaging	1.00
R5076:Clstn2	UTSW	9	97483079	missense	probably damaging	1.00
R5122:Clstn2	UTSW	9	97461421	missense	probably damaging	1.00
R5155:Clstn2	UTSW	9	97456431	missense	probably benign	0.02
R5560:Clstn2	UTSW	9	97469819	missense	possibly damaging	0.95
R6009:Clstn2	UTSW	9	97456526	missense	probably benign	0.05
R6011:Clstn2	UTSW	9	97456526	missense	probably benign	0.05
R6029:Clstn2	UTSW	9	97456581	missense	probably benign	0.00
R6093:Clstn2	UTSW	9	97458210	missense	probably damaging	1.00
R6284:Clstn2	UTSW	9	97454674	missense	probably benign
R6676:Clstn2	UTSW	9	97461531	missense	probably damaging	1.00
R6902:Clstn2	UTSW	9	97469822	missense	probably damaging	1.00
R6946:Clstn2	UTSW	9	97469822	missense	probably damaging	1.00
R6966:Clstn2	UTSW	9	97526406	nonsense	probably null
R7329:Clstn2	UTSW	9	97461369	missense	probably benign	0.00
R7330:Clstn2	UTSW	9	97461369	missense	probably benign	0.00
R7382:Clstn2	UTSW	9	97799398	nonsense	probably null
R7410:Clstn2	UTSW	9	97541867	missense	probably benign	0.06
R7549:Clstn2	UTSW	9	97582544	missense	probably benign	0.01
R7879:Clstn2	UTSW	9	97469764	missense	possibly damaging	0.90
R8070:Clstn2	UTSW	9	97799470	missense	possibly damaging	0.79
R8193:Clstn2	UTSW	9	97583630	missense	probably damaging	1.00
R8422:Clstn2	UTSW	9	97458186	missense	probably benign	0.39
R9190:Clstn2	UTSW	9	97532762	missense	probably damaging	1.00
R9221:Clstn2	UTSW	9	97461342	missense	probably benign	0.00
R9305:Clstn2	UTSW	9	97461484	missense	probably damaging	1.00
R9347:Clstn2	UTSW	9	97582601	missense	probably damaging	1.00
R9520:Clstn2	UTSW	9	97532710	missense	probably damaging	1.00
X0027:Clstn2	UTSW	9	97526399	missense	probably damaging	1.00
Z1177:Clstn2	UTSW	9	97461356	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTCTGAACGAATGTGGGAATGG -3'
(R):5'- AGCCTGTGGGTAAATTGCCC -3'

Sequencing Primer
(F):5'- GAATGGCCAGGTGGGTC -3'
(R):5'- TGGGTAAATTGCCCCCATAC -3'

Posted On

2022-11-14