Incidental Mutation 'R9751:Meioc'
ID 732527
Institutional Source Beutler Lab
Gene Symbol Meioc
Ensembl Gene ENSMUSG00000051455
Gene Name meiosis specific with coiled-coil domain
Synonyms LOC380729, LOC268491, Gm1564
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R9751 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 102556177-102573066 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 102566419 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 678 (Y678*)
Ref Sequence ENSEMBL: ENSMUSP00000097947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100378] [ENSMUST00000156590]
AlphaFold A2AG06
Predicted Effect probably null
Transcript: ENSMUST00000100378
AA Change: Y678*
SMART Domains Protein: ENSMUSP00000097947
Gene: ENSMUSG00000051455
AA Change: Y678*

DomainStartEndE-ValueType
low complexity region 526 537 N/A INTRINSIC
low complexity region 712 728 N/A INTRINSIC
Pfam:DUF4582 757 922 5.1e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156590
SMART Domains Protein: ENSMUSP00000116246
Gene: ENSMUSG00000051455

DomainStartEndE-ValueType
low complexity region 470 481 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit infertility with small gonads, absent germ cells and arrested meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,881,126 (GRCm39) N514D probably benign Het
Adgre1 G A 17: 57,757,101 (GRCm39) R786H probably null Het
Ankrd7 G A 6: 18,868,024 (GRCm39) V97I probably damaging Het
Bltp1 A G 3: 37,065,889 (GRCm39) I54M Het
Bmper C T 9: 23,318,009 (GRCm39) P543S possibly damaging Het
Brwd1 A T 16: 95,795,015 (GRCm39) M2233K possibly damaging Het
C1s2 G T 6: 124,602,553 (GRCm39) P553T probably damaging Het
Cachd1 G A 4: 100,823,438 (GRCm39) V497I possibly damaging Het
Cacng4 A G 11: 107,626,019 (GRCm39) S191P probably damaging Het
Cd109 C A 9: 78,605,442 (GRCm39) T1015K probably damaging Het
Clstn2 A G 9: 97,339,703 (GRCm39) L756P probably damaging Het
Crybg3 A T 16: 59,377,887 (GRCm39) D1122E possibly damaging Het
Csf2 A T 11: 54,140,420 (GRCm39) L6* probably null Het
Csnk1g2 T A 10: 80,473,745 (GRCm39) Y71N possibly damaging Het
Dlg2 C A 7: 90,564,731 (GRCm39) H116N probably benign Het
Dnah14 C T 1: 181,619,610 (GRCm39) S3978L probably damaging Het
Dpp8 C T 9: 64,960,453 (GRCm39) T328I probably null Het
Dync2i1 T A 12: 116,205,403 (GRCm39) probably null Het
Dysf T C 6: 84,163,450 (GRCm39) V1625A probably damaging Het
Efcab3 G A 11: 104,783,911 (GRCm39) G2754E probably benign Het
Egf C A 3: 129,548,538 (GRCm39) V26F probably damaging Het
Eif1ad19 T C 12: 87,740,526 (GRCm39) N11S possibly damaging Het
Fam20a T A 11: 109,565,992 (GRCm39) Y414F probably damaging Het
Fsip2 T C 2: 82,818,241 (GRCm39) I4658T probably benign Het
Hycc1 C T 5: 24,196,748 (GRCm39) E47K probably benign Het
Igflr1 A T 7: 30,266,653 (GRCm39) Q167L possibly damaging Het
Krt79 T G 15: 101,839,196 (GRCm39) E424D probably benign Het
Map3k6 A G 4: 132,979,168 (GRCm39) probably null Het
Mcpt4 A G 14: 56,297,511 (GRCm39) I215T probably damaging Het
Med13 T C 11: 86,189,984 (GRCm39) Y975C probably damaging Het
Myof T C 19: 37,924,818 (GRCm39) T1190A probably benign Het
Nap1l4 A C 7: 143,088,132 (GRCm39) probably benign Het
Ncapg T C 5: 45,851,195 (GRCm39) V796A probably damaging Het
Or4c10b C T 2: 89,711,956 (GRCm39) T262I probably benign Het
Or4c119 C T 2: 88,986,782 (GRCm39) V246M possibly damaging Het
Or5d39 T A 2: 87,979,614 (GRCm39) I250L probably benign Het
Or5d40 T A 2: 88,015,260 (GRCm39) V13E possibly damaging Het
Or5p68 T C 7: 107,945,645 (GRCm39) Y181C probably benign Het
Paxbp1 A G 16: 90,824,188 (GRCm39) S515P probably benign Het
Pip4p1 A G 14: 51,165,436 (GRCm39) V257A probably benign Het
Plce1 C T 19: 38,717,414 (GRCm39) S1401F probably damaging Het
Rptor A G 11: 119,777,964 (GRCm39) K1043E probably benign Het
Rtn4rl2 T G 2: 84,711,039 (GRCm39) N75T probably damaging Het
Slc35f4 A G 14: 49,536,291 (GRCm39) I448T possibly damaging Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,278,612 (GRCm39) probably benign Het
Tas2r115 A G 6: 132,714,918 (GRCm39) I11T possibly damaging Het
Tbc1d5 A G 17: 51,181,680 (GRCm39) V351A possibly damaging Het
Trim43b A T 9: 88,971,570 (GRCm39) D195E probably benign Het
Trim65 C A 11: 116,021,564 (GRCm39) A90S probably benign Het
Trip11 C T 12: 101,850,765 (GRCm39) V1100I possibly damaging Het
Tyrp1 A G 4: 80,759,012 (GRCm39) E295G probably null Het
Ube2g2 G A 10: 77,480,307 (GRCm39) V138I probably benign Het
Other mutations in Meioc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Meioc APN 11 102,565,113 (GRCm39) missense probably benign 0.33
IGL01952:Meioc APN 11 102,563,011 (GRCm39) missense possibly damaging 0.79
IGL02006:Meioc APN 11 102,565,092 (GRCm39) missense probably damaging 1.00
IGL02195:Meioc APN 11 102,565,683 (GRCm39) missense possibly damaging 0.91
IGL02339:Meioc APN 11 102,559,274 (GRCm39) missense probably benign 0.18
IGL02935:Meioc APN 11 102,563,017 (GRCm39) missense probably benign 0.06
IGL03294:Meioc APN 11 102,571,495 (GRCm39) missense probably damaging 1.00
PIT4519001:Meioc UTSW 11 102,570,783 (GRCm39) missense probably damaging 1.00
R0285:Meioc UTSW 11 102,563,017 (GRCm39) missense probably benign 0.06
R0964:Meioc UTSW 11 102,570,857 (GRCm39) missense probably damaging 1.00
R1074:Meioc UTSW 11 102,566,219 (GRCm39) missense probably damaging 1.00
R2024:Meioc UTSW 11 102,566,184 (GRCm39) missense probably benign 0.00
R4012:Meioc UTSW 11 102,566,654 (GRCm39) missense probably damaging 0.99
R4429:Meioc UTSW 11 102,566,546 (GRCm39) missense probably damaging 1.00
R4491:Meioc UTSW 11 102,565,746 (GRCm39) missense possibly damaging 0.84
R4594:Meioc UTSW 11 102,564,992 (GRCm39) missense probably damaging 1.00
R4752:Meioc UTSW 11 102,565,259 (GRCm39) missense probably benign 0.00
R5301:Meioc UTSW 11 102,570,871 (GRCm39) missense probably damaging 1.00
R5352:Meioc UTSW 11 102,566,139 (GRCm39) missense probably benign 0.03
R5646:Meioc UTSW 11 102,566,083 (GRCm39) missense possibly damaging 0.94
R5958:Meioc UTSW 11 102,565,979 (GRCm39) missense probably benign 0.41
R5968:Meioc UTSW 11 102,566,657 (GRCm39) missense probably damaging 0.99
R6157:Meioc UTSW 11 102,559,227 (GRCm39) missense probably damaging 1.00
R6410:Meioc UTSW 11 102,565,860 (GRCm39) missense probably benign 0.00
R6644:Meioc UTSW 11 102,559,286 (GRCm39) critical splice donor site probably null
R7285:Meioc UTSW 11 102,557,168 (GRCm39) missense probably benign 0.00
R7440:Meioc UTSW 11 102,565,063 (GRCm39) missense possibly damaging 0.67
R7815:Meioc UTSW 11 102,566,414 (GRCm39) missense probably damaging 1.00
R7984:Meioc UTSW 11 102,565,432 (GRCm39) missense possibly damaging 0.94
R8009:Meioc UTSW 11 102,567,569 (GRCm39) missense probably damaging 1.00
R8078:Meioc UTSW 11 102,559,226 (GRCm39) nonsense probably null
R8195:Meioc UTSW 11 102,565,893 (GRCm39) nonsense probably null
R8429:Meioc UTSW 11 102,565,032 (GRCm39) missense probably benign 0.06
R8797:Meioc UTSW 11 102,567,686 (GRCm39) nonsense probably null
R8854:Meioc UTSW 11 102,566,589 (GRCm39) missense probably damaging 0.98
R8891:Meioc UTSW 11 102,559,246 (GRCm39) missense probably benign 0.43
R9081:Meioc UTSW 11 102,565,001 (GRCm39) missense probably benign 0.00
R9360:Meioc UTSW 11 102,565,779 (GRCm39) missense probably benign 0.13
R9539:Meioc UTSW 11 102,565,506 (GRCm39) missense probably damaging 0.99
R9549:Meioc UTSW 11 102,556,550 (GRCm39) intron probably benign
Z1177:Meioc UTSW 11 102,557,190 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTGGACATTATGATCCTGAGGAC -3'
(R):5'- GTCCACTACGGGTTTTAATTGGTC -3'

Sequencing Primer
(F):5'- GGACATTATGATCCTGAGGACATTCC -3'
(R):5'- CGGGTTTTAATTGGTCTTTGAAATCC -3'
Posted On 2022-11-14