Incidental Mutation 'R9751:Gm11639'
ID 732528
Institutional Source Beutler Lab
Gene Symbol Gm11639
Ensembl Gene ENSMUSG00000040838
Gene Name predicted gene 11639
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R9751 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 104685707-105117394 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 104893085 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 2754 (G2754E)
Ref Sequence ENSEMBL: ENSMUSP00000148433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000212287]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000212287
AA Change: G2754E

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,011,740 I54M Het
Abca4 A G 3: 122,087,477 N514D probably benign Het
Adgre1 G A 17: 57,450,101 R786H probably null Het
Ankrd7 G A 6: 18,868,025 V97I probably damaging Het
Bmper C T 9: 23,406,713 P543S possibly damaging Het
Brwd1 A T 16: 95,993,815 M2233K possibly damaging Het
C1s2 G T 6: 124,625,594 P553T probably damaging Het
Cachd1 G A 4: 100,966,241 V497I possibly damaging Het
Cacng4 A G 11: 107,735,193 S191P probably damaging Het
Cd109 C A 9: 78,698,160 T1015K probably damaging Het
Clstn2 A G 9: 97,457,650 L756P probably damaging Het
Crybg3 A T 16: 59,557,524 D1122E possibly damaging Het
Csf2 A T 11: 54,249,594 L6* probably null Het
Csnk1g2 T A 10: 80,637,911 Y71N possibly damaging Het
Dlg2 C A 7: 90,915,523 H116N probably benign Het
Dnah14 C T 1: 181,792,045 S3978L probably damaging Het
Dpp8 C T 9: 65,053,171 T328I probably null Het
Dysf T C 6: 84,186,468 V1625A probably damaging Het
Egf C A 3: 129,754,889 V26F probably damaging Het
Fam126a C T 5: 23,991,750 E47K probably benign Het
Fam20a T A 11: 109,675,166 Y414F probably damaging Het
Fsip2 T C 2: 82,987,897 I4658T probably benign Het
Gm21319 T C 12: 87,773,756 N11S possibly damaging Het
Igflr1 A T 7: 30,567,228 Q167L possibly damaging Het
Krt79 T G 15: 101,930,761 E424D probably benign Het
Map3k6 A G 4: 133,251,857 probably null Het
Mcpt4 A G 14: 56,060,054 I215T probably damaging Het
Med13 T C 11: 86,299,158 Y975C probably damaging Het
Meioc T A 11: 102,675,593 Y678* probably null Het
Myof T C 19: 37,936,370 T1190A probably benign Het
Nap1l4 A C 7: 143,534,395 probably benign Het
Ncapg T C 5: 45,693,853 V796A probably damaging Het
Olfr1167 T A 2: 88,149,270 I250L probably benign Het
Olfr1168 T A 2: 88,184,916 V13E possibly damaging Het
Olfr1224-ps1 C T 2: 89,156,438 V246M possibly damaging Het
Olfr1257 C T 2: 89,881,612 T262I probably benign Het
Olfr493 T C 7: 108,346,438 Y181C probably benign Het
Paxbp1 A G 16: 91,027,300 S515P probably benign Het
Plce1 C T 19: 38,728,970 S1401F probably damaging Het
Rptor A G 11: 119,887,138 K1043E probably benign Het
Rtn4rl2 T G 2: 84,880,695 N75T probably damaging Het
Slc35f4 A G 14: 49,298,834 I448T possibly damaging Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,301,649 probably benign Het
Tas2r115 A G 6: 132,737,955 I11T possibly damaging Het
Tbc1d5 A G 17: 50,874,652 V351A possibly damaging Het
Tmem55b A G 14: 50,927,979 V257A probably benign Het
Trim43b A T 9: 89,089,517 D195E probably benign Het
Trim65 C A 11: 116,130,738 A90S probably benign Het
Trip11 C T 12: 101,884,506 V1100I possibly damaging Het
Tyrp1 A G 4: 80,840,775 E295G probably null Het
Ube2g2 G A 10: 77,644,473 V138I probably benign Het
Wdr60 T A 12: 116,241,783 probably null Het
Other mutations in Gm11639
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Gm11639 APN 11 105100021 missense probably damaging 1.00
IGL01308:Gm11639 APN 11 104720697 missense probably benign 0.03
IGL01483:Gm11639 APN 11 104739347 missense probably benign 0.03
IGL01695:Gm11639 APN 11 104736063 missense probably damaging 1.00
IGL01860:Gm11639 APN 11 104690921 missense probably benign 0.16
IGL01981:Gm11639 APN 11 104721432 intron probably benign
IGL01984:Gm11639 APN 11 104738308 missense probably benign 0.20
IGL02023:Gm11639 APN 11 104721432 intron probably benign
IGL02252:Gm11639 APN 11 104753927 missense possibly damaging 0.68
IGL02886:Gm11639 APN 11 105095874 missense possibly damaging 0.95
IGL03116:Gm11639 APN 11 104721533 missense probably benign 0.02
IGL03141:Gm11639 APN 11 105095870 missense probably damaging 0.99
IGL03242:Gm11639 APN 11 105106404 missense probably damaging 1.00
IGL03274:Gm11639 APN 11 104721093 missense probably benign 0.03
IGL03408:Gm11639 APN 11 104710621 missense probably benign 0.03
R0018:Gm11639 UTSW 11 104721552 critical splice donor site probably null
R0068:Gm11639 UTSW 11 104720822 missense probably benign 0.29
R0350:Gm11639 UTSW 11 104690880 missense probably benign 0.03
R0646:Gm11639 UTSW 11 104720501 missense probably benign 0.03
R0668:Gm11639 UTSW 11 104720492 missense probably benign 0.16
R0715:Gm11639 UTSW 11 104720880 missense possibly damaging 0.90
R0944:Gm11639 UTSW 11 104710730 splice site probably null
R1330:Gm11639 UTSW 11 104746290 missense possibly damaging 0.84
R1508:Gm11639 UTSW 11 104710677 missense probably benign 0.03
R1643:Gm11639 UTSW 11 104698978 missense probably benign 0.16
R1651:Gm11639 UTSW 11 104720666 missense probably benign 0.03
R1665:Gm11639 UTSW 11 104721114 missense probably benign 0.07
R1702:Gm11639 UTSW 11 104691006 missense probably benign 0.03
R1711:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1779:Gm11639 UTSW 11 104720939 missense probably benign 0.15
R1813:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1818:Gm11639 UTSW 11 104721507 missense probably benign 0.10
R1896:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1969:Gm11639 UTSW 11 104746264 missense probably damaging 1.00
R2139:Gm11639 UTSW 11 104751911 missense possibly damaging 0.53
R2165:Gm11639 UTSW 11 104751862 missense possibly damaging 0.93
R2359:Gm11639 UTSW 11 104739280 missense possibly damaging 0.80
R2394:Gm11639 UTSW 11 104738295 missense probably benign 0.17
R2406:Gm11639 UTSW 11 104720631 missense probably benign 0.03
R2570:Gm11639 UTSW 11 104733664 missense probably damaging 1.00
R3795:Gm11639 UTSW 11 104733675 missense possibly damaging 0.94
R4352:Gm11639 UTSW 11 104739314 missense probably null 0.25
R4359:Gm11639 UTSW 11 104733721 splice site probably null
R4424:Gm11639 UTSW 11 104736114 critical splice donor site probably null
R4895:Gm11639 UTSW 11 104720286 missense probably benign 0.16
R4895:Gm11639 UTSW 11 104749670 missense probably damaging 1.00
R5006:Gm11639 UTSW 11 104729677 splice site probably null
R5066:Gm11639 UTSW 11 104720664 missense probably benign 0.03
R5329:Gm11639 UTSW 11 104753806 splice site probably null
R5405:Gm11639 UTSW 11 104721192 missense probably benign 0.07
R5814:Gm11639 UTSW 11 104736114 critical splice donor site probably benign
R5888:Gm11639 UTSW 11 104721401 splice site probably benign
R5910:Gm11639 UTSW 11 104690934 missense probably benign 0.01
R5975:Gm11639 UTSW 11 104687549 start gained probably benign
R6019:Gm11639 UTSW 11 105042902 critical splice donor site probably null
R6028:Gm11639 UTSW 11 104769655 critical splice donor site probably null
R6048:Gm11639 UTSW 11 104944433 missense unknown
R6059:Gm11639 UTSW 11 105036769 missense probably benign 0.03
R6147:Gm11639 UTSW 11 104967740 missense unknown
R6176:Gm11639 UTSW 11 104792557 missense probably benign 0.16
R6181:Gm11639 UTSW 11 104831333 missense probably benign 0.25
R6196:Gm11639 UTSW 11 104855560 missense probably benign 0.07
R6245:Gm11639 UTSW 11 104785008 missense probably benign 0.03
R6262:Gm11639 UTSW 11 104893753 missense probably benign 0.24
R6263:Gm11639 UTSW 11 104919486 missense unknown
R6277:Gm11639 UTSW 11 105010322 missense possibly damaging 0.49
R6338:Gm11639 UTSW 11 104843208 nonsense probably null
R6355:Gm11639 UTSW 11 105005685 missense probably benign 0.29
R6356:Gm11639 UTSW 11 104893707 missense probably benign 0.19
R6365:Gm11639 UTSW 11 104924586 missense unknown
R6391:Gm11639 UTSW 11 104994317 missense possibly damaging 0.92
R6556:Gm11639 UTSW 11 105008251 missense probably null 0.03
R6604:Gm11639 UTSW 11 104698946 nonsense probably null
R6605:Gm11639 UTSW 11 104999281 splice site probably null
R6634:Gm11639 UTSW 11 104893783 missense probably benign 0.17
R6851:Gm11639 UTSW 11 105005695 missense probably benign 0.03
R6862:Gm11639 UTSW 11 104721458 nonsense probably null
R6949:Gm11639 UTSW 11 104909070 missense probably damaging 1.00
R6970:Gm11639 UTSW 11 104776356 missense probably benign 0.03
R7014:Gm11639 UTSW 11 104693422 missense probably benign 0.03
R7097:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7122:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7124:Gm11639 UTSW 11 104738274 missense probably benign 0.17
R7146:Gm11639 UTSW 11 104967752 missense unknown
R7146:Gm11639 UTSW 11 105022938 missense probably benign 0.03
R7154:Gm11639 UTSW 11 104699140 splice site probably null
R7175:Gm11639 UTSW 11 104947411 missense unknown
R7198:Gm11639 UTSW 11 104751885 missense probably benign 0.15
R7211:Gm11639 UTSW 11 104710713 missense probably benign 0.01
R7211:Gm11639 UTSW 11 104724609 critical splice donor site probably null
R7216:Gm11639 UTSW 11 104880549 missense possibly damaging 0.49
R7221:Gm11639 UTSW 11 104900606 missense probably benign 0.36
R7233:Gm11639 UTSW 11 104839843 missense possibly damaging 0.69
R7236:Gm11639 UTSW 11 104899267 missense probably benign 0.10
R7262:Gm11639 UTSW 11 104854606 critical splice donor site probably null
R7289:Gm11639 UTSW 11 105038358 missense probably benign 0.24
R7323:Gm11639 UTSW 11 105030011 missense probably benign 0.07
R7378:Gm11639 UTSW 11 104714702 missense probably benign 0.03
R7388:Gm11639 UTSW 11 104721045 missense probably damaging 0.97
R7390:Gm11639 UTSW 11 104724585 missense possibly damaging 0.46
R7411:Gm11639 UTSW 11 104999723 missense probably benign 0.10
R7468:Gm11639 UTSW 11 104749700 missense probably benign 0.17
R7497:Gm11639 UTSW 11 104762690 critical splice donor site probably null
R7620:Gm11639 UTSW 11 104832143 missense possibly damaging 0.95
R7638:Gm11639 UTSW 11 105036799 missense probably benign 0.03
R7661:Gm11639 UTSW 11 104726677 missense probably benign 0.03
R7667:Gm11639 UTSW 11 104751911 missense possibly damaging 0.53
R7682:Gm11639 UTSW 11 104964348 splice site probably null
R7708:Gm11639 UTSW 11 104964571 missense unknown
R7721:Gm11639 UTSW 11 104724540 nonsense probably null
R7747:Gm11639 UTSW 11 104842603 missense probably damaging 0.96
R7840:Gm11639 UTSW 11 104733713 missense probably benign 0.07
R7846:Gm11639 UTSW 11 104714745 critical splice donor site probably null
R7893:Gm11639 UTSW 11 104979360 missense unknown
R7897:Gm11639 UTSW 11 104998235 missense probably benign 0.24
R7936:Gm11639 UTSW 11 104999698 missense possibly damaging 0.89
R7936:Gm11639 UTSW 11 105046559 critical splice donor site probably null
R7959:Gm11639 UTSW 11 105042801 missense probably damaging 0.96
R8031:Gm11639 UTSW 11 104881469 missense possibly damaging 0.49
R8041:Gm11639 UTSW 11 104919479 missense unknown
R8054:Gm11639 UTSW 11 104730400 missense probably benign 0.07
R8056:Gm11639 UTSW 11 104909070 missense probably damaging 0.98
R8088:Gm11639 UTSW 11 104998246 missense probably benign 0.10
R8112:Gm11639 UTSW 11 104950200 missense unknown
R8340:Gm11639 UTSW 11 104986030 missense unknown
R8405:Gm11639 UTSW 11 104721198 missense probably benign 0.02
R8413:Gm11639 UTSW 11 104920309 missense unknown
R8472:Gm11639 UTSW 11 104818637 missense probably benign 0.07
R8549:Gm11639 UTSW 11 104999695 missense probably damaging 0.99
R8699:Gm11639 UTSW 11 104781246 missense probably benign 0.03
R8711:Gm11639 UTSW 11 104852545 missense probably benign 0.03
R8732:Gm11639 UTSW 11 104804274 missense probably benign 0.03
R8745:Gm11639 UTSW 11 104858478 missense possibly damaging 0.57
R8806:Gm11639 UTSW 11 105037869 missense probably benign 0.07
R8810:Gm11639 UTSW 11 104914895 missense unknown
R8845:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R8870:Gm11639 UTSW 11 104900674 missense probably benign 0.07
R8872:Gm11639 UTSW 11 104870054 missense probably benign 0.19
R8879:Gm11639 UTSW 11 104690955 missense probably benign 0.03
R8924:Gm11639 UTSW 11 104915427 frame shift probably null
R8954:Gm11639 UTSW 11 105018699 critical splice donor site probably null
R8960:Gm11639 UTSW 11 104929946 splice site probably benign
R8975:Gm11639 UTSW 11 105063589 missense probably benign 0.17
R8988:Gm11639 UTSW 11 105020526 missense probably benign 0.07
R8998:Gm11639 UTSW 11 104749651 missense probably benign 0.09
R8999:Gm11639 UTSW 11 104749651 missense probably benign 0.09
R9002:Gm11639 UTSW 11 105029996 missense probably damaging 0.99
R9012:Gm11639 UTSW 11 104820521 critical splice donor site probably null
R9036:Gm11639 UTSW 11 105036775 missense probably benign 0.03
R9037:Gm11639 UTSW 11 104912965 missense unknown
R9059:Gm11639 UTSW 11 104751863 missense possibly damaging 0.73
R9066:Gm11639 UTSW 11 104740862 intron probably benign
R9122:Gm11639 UTSW 11 104965779 missense unknown
R9125:Gm11639 UTSW 11 104845534 missense probably damaging 1.00
R9127:Gm11639 UTSW 11 104850581 missense probably benign 0.07
R9171:Gm11639 UTSW 11 104909882 missense probably benign 0.36
R9219:Gm11639 UTSW 11 104945865 missense unknown
R9224:Gm11639 UTSW 11 104770975 missense probably benign 0.07
R9235:Gm11639 UTSW 11 105017161 missense probably benign 0.19
R9294:Gm11639 UTSW 11 104831300 missense probably benign 0.24
R9318:Gm11639 UTSW 11 104965822 critical splice donor site probably null
R9322:Gm11639 UTSW 11 104874373 missense probably benign 0.36
R9361:Gm11639 UTSW 11 105005698 missense probably benign 0.03
R9408:Gm11639 UTSW 11 104730429 critical splice donor site probably null
R9434:Gm11639 UTSW 11 105009037 missense probably benign 0.24
R9477:Gm11639 UTSW 11 104945872 missense unknown
R9658:Gm11639 UTSW 11 104720294 missense probably benign 0.03
R9719:Gm11639 UTSW 11 104977086 missense unknown
R9763:Gm11639 UTSW 11 104999659 missense possibly damaging 0.89
X0026:Gm11639 UTSW 11 104720975 missense probably benign 0.07
Z1088:Gm11639 UTSW 11 104751902 missense probably damaging 0.96
Z1176:Gm11639 UTSW 11 105001967 missense probably benign 0.29
Z1177:Gm11639 UTSW 11 104739338 nonsense probably null
Z1177:Gm11639 UTSW 11 104820518 missense probably benign 0.03
Z1177:Gm11639 UTSW 11 104924019 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCCTTGATGTTGACATGGCTTTAC -3'
(R):5'- CTGGACTAGGTGCTAGTAAGC -3'

Sequencing Primer
(F):5'- GTTGACATGGCTTTACATTTTCATC -3'
(R):5'- TAGTAAGCAAGCAACAAACACAGATG -3'
Posted On 2022-11-14