Incidental Mutation 'R9751:Fam20a'
ID 732530
Institutional Source Beutler Lab
Gene Symbol Fam20a
Ensembl Gene ENSMUSG00000020614
Gene Name FAM20A, golgi associated secretory pathway pseudokinase
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9751 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 109563752-109613989 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 109565992 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 414 (Y414F)
Ref Sequence ENSEMBL: ENSMUSP00000020938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020938] [ENSMUST00000155559]
AlphaFold Q8CID3
Predicted Effect probably damaging
Transcript: ENSMUST00000020938
AA Change: Y414F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020938
Gene: ENSMUSG00000020614
AA Change: Y414F

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
Pfam:Fam20C 306 522 8.9e-101 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155559
AA Change: Y414F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116687
Gene: ENSMUSG00000020614
AA Change: Y414F

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
Pfam:DUF1193 305 525 3.2e-103 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a protein that is likely secreted and may function in hematopoiesis. A mutation at this locus has been associated with amelogenesis imperfecta and gingival hyperplasia syndrome. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal ameloblast morphology, disrupted dental enamel formation in both incisor and molar teeth, abnormal kidney morphology, disseminated calcifications of muscular arteries, and intrapulmonary calcifications. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,881,126 (GRCm39) N514D probably benign Het
Adgre1 G A 17: 57,757,101 (GRCm39) R786H probably null Het
Ankrd7 G A 6: 18,868,024 (GRCm39) V97I probably damaging Het
Bltp1 A G 3: 37,065,889 (GRCm39) I54M Het
Bmper C T 9: 23,318,009 (GRCm39) P543S possibly damaging Het
Brwd1 A T 16: 95,795,015 (GRCm39) M2233K possibly damaging Het
C1s2 G T 6: 124,602,553 (GRCm39) P553T probably damaging Het
Cachd1 G A 4: 100,823,438 (GRCm39) V497I possibly damaging Het
Cacng4 A G 11: 107,626,019 (GRCm39) S191P probably damaging Het
Cd109 C A 9: 78,605,442 (GRCm39) T1015K probably damaging Het
Clstn2 A G 9: 97,339,703 (GRCm39) L756P probably damaging Het
Crybg3 A T 16: 59,377,887 (GRCm39) D1122E possibly damaging Het
Csf2 A T 11: 54,140,420 (GRCm39) L6* probably null Het
Csnk1g2 T A 10: 80,473,745 (GRCm39) Y71N possibly damaging Het
Dlg2 C A 7: 90,564,731 (GRCm39) H116N probably benign Het
Dnah14 C T 1: 181,619,610 (GRCm39) S3978L probably damaging Het
Dpp8 C T 9: 64,960,453 (GRCm39) T328I probably null Het
Dync2i1 T A 12: 116,205,403 (GRCm39) probably null Het
Dysf T C 6: 84,163,450 (GRCm39) V1625A probably damaging Het
Efcab3 G A 11: 104,783,911 (GRCm39) G2754E probably benign Het
Egf C A 3: 129,548,538 (GRCm39) V26F probably damaging Het
Eif1ad19 T C 12: 87,740,526 (GRCm39) N11S possibly damaging Het
Fsip2 T C 2: 82,818,241 (GRCm39) I4658T probably benign Het
Hycc1 C T 5: 24,196,748 (GRCm39) E47K probably benign Het
Igflr1 A T 7: 30,266,653 (GRCm39) Q167L possibly damaging Het
Krt79 T G 15: 101,839,196 (GRCm39) E424D probably benign Het
Map3k6 A G 4: 132,979,168 (GRCm39) probably null Het
Mcpt4 A G 14: 56,297,511 (GRCm39) I215T probably damaging Het
Med13 T C 11: 86,189,984 (GRCm39) Y975C probably damaging Het
Meioc T A 11: 102,566,419 (GRCm39) Y678* probably null Het
Myof T C 19: 37,924,818 (GRCm39) T1190A probably benign Het
Nap1l4 A C 7: 143,088,132 (GRCm39) probably benign Het
Ncapg T C 5: 45,851,195 (GRCm39) V796A probably damaging Het
Or4c10b C T 2: 89,711,956 (GRCm39) T262I probably benign Het
Or4c119 C T 2: 88,986,782 (GRCm39) V246M possibly damaging Het
Or5d39 T A 2: 87,979,614 (GRCm39) I250L probably benign Het
Or5d40 T A 2: 88,015,260 (GRCm39) V13E possibly damaging Het
Or5p68 T C 7: 107,945,645 (GRCm39) Y181C probably benign Het
Paxbp1 A G 16: 90,824,188 (GRCm39) S515P probably benign Het
Pip4p1 A G 14: 51,165,436 (GRCm39) V257A probably benign Het
Plce1 C T 19: 38,717,414 (GRCm39) S1401F probably damaging Het
Rptor A G 11: 119,777,964 (GRCm39) K1043E probably benign Het
Rtn4rl2 T G 2: 84,711,039 (GRCm39) N75T probably damaging Het
Slc35f4 A G 14: 49,536,291 (GRCm39) I448T possibly damaging Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,278,612 (GRCm39) probably benign Het
Tas2r115 A G 6: 132,714,918 (GRCm39) I11T possibly damaging Het
Tbc1d5 A G 17: 51,181,680 (GRCm39) V351A possibly damaging Het
Trim43b A T 9: 88,971,570 (GRCm39) D195E probably benign Het
Trim65 C A 11: 116,021,564 (GRCm39) A90S probably benign Het
Trip11 C T 12: 101,850,765 (GRCm39) V1100I possibly damaging Het
Tyrp1 A G 4: 80,759,012 (GRCm39) E295G probably null Het
Ube2g2 G A 10: 77,480,307 (GRCm39) V138I probably benign Het
Other mutations in Fam20a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Fam20a APN 11 109,568,588 (GRCm39) splice site probably benign
IGL01296:Fam20a APN 11 109,576,177 (GRCm39) missense possibly damaging 0.93
IGL01319:Fam20a APN 11 109,569,284 (GRCm39) splice site probably benign
IGL01322:Fam20a APN 11 109,573,738 (GRCm39) missense probably damaging 1.00
IGL02086:Fam20a APN 11 109,564,239 (GRCm39) missense probably benign 0.00
IGL02563:Fam20a APN 11 109,568,620 (GRCm39) missense possibly damaging 0.53
IGL02883:Fam20a APN 11 109,565,953 (GRCm39) missense probably damaging 0.99
IGL02893:Fam20a APN 11 109,612,414 (GRCm39) missense probably benign 0.00
Infamy UTSW 11 109,564,168 (GRCm39) missense possibly damaging 0.87
snide UTSW 11 109,612,201 (GRCm39) missense possibly damaging 0.92
ungainly UTSW 11 109,573,696 (GRCm39) nonsense probably null
P0026:Fam20a UTSW 11 109,566,667 (GRCm39) critical splice donor site probably null
R0726:Fam20a UTSW 11 109,568,020 (GRCm39) missense probably damaging 1.00
R1317:Fam20a UTSW 11 109,568,664 (GRCm39) missense probably damaging 0.99
R1462:Fam20a UTSW 11 109,568,143 (GRCm39) missense probably damaging 1.00
R1462:Fam20a UTSW 11 109,568,143 (GRCm39) missense probably damaging 1.00
R1751:Fam20a UTSW 11 109,568,664 (GRCm39) missense probably damaging 0.99
R1761:Fam20a UTSW 11 109,568,664 (GRCm39) missense probably damaging 0.99
R1889:Fam20a UTSW 11 109,564,380 (GRCm39) missense probably benign 0.30
R1895:Fam20a UTSW 11 109,564,380 (GRCm39) missense probably benign 0.30
R1971:Fam20a UTSW 11 109,576,237 (GRCm39) missense probably damaging 1.00
R2192:Fam20a UTSW 11 109,565,449 (GRCm39) missense probably benign 0.13
R3745:Fam20a UTSW 11 109,568,616 (GRCm39) missense probably benign 0.17
R4684:Fam20a UTSW 11 109,612,513 (GRCm39) missense unknown
R4835:Fam20a UTSW 11 109,564,389 (GRCm39) missense probably benign 0.40
R5045:Fam20a UTSW 11 109,568,711 (GRCm39) missense probably benign 0.38
R5161:Fam20a UTSW 11 109,564,196 (GRCm39) missense probably benign 0.00
R5715:Fam20a UTSW 11 109,569,257 (GRCm39) missense probably damaging 1.00
R5817:Fam20a UTSW 11 109,564,244 (GRCm39) missense possibly damaging 0.81
R5960:Fam20a UTSW 11 109,566,795 (GRCm39) intron probably benign
R6162:Fam20a UTSW 11 109,573,696 (GRCm39) nonsense probably null
R6312:Fam20a UTSW 11 109,565,456 (GRCm39) missense probably damaging 1.00
R7231:Fam20a UTSW 11 109,612,201 (GRCm39) missense possibly damaging 0.92
R7311:Fam20a UTSW 11 109,565,454 (GRCm39) nonsense probably null
R7366:Fam20a UTSW 11 109,564,168 (GRCm39) missense possibly damaging 0.87
R8013:Fam20a UTSW 11 109,576,332 (GRCm39) missense possibly damaging 0.92
R8014:Fam20a UTSW 11 109,576,332 (GRCm39) missense possibly damaging 0.92
R9086:Fam20a UTSW 11 109,566,754 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACTGGAGAGTCTGTGCTAC -3'
(R):5'- AGCCCAACAGCTGTGTGTAC -3'

Sequencing Primer
(F):5'- TGCTACTTAGCAAAGGGC -3'
(R):5'- ACAGTTCTGCTCACCAGGCTG -3'
Posted On 2022-11-14