Incidental Mutation 'R9751:Fam20a'
ID 732530
Institutional Source Beutler Lab
Gene Symbol Fam20a
Ensembl Gene ENSMUSG00000020614
Gene Name family with sequence similarity 20, member A
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_153782.1; MGI:2388266
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9751 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 109669749-109722279 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 109675166 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 414 (Y414F)
Ref Sequence ENSEMBL: ENSMUSP00000020938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020938] [ENSMUST00000155559]
AlphaFold Q8CID3
Predicted Effect probably damaging
Transcript: ENSMUST00000020938
AA Change: Y414F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020938
Gene: ENSMUSG00000020614
AA Change: Y414F

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
Pfam:Fam20C 306 522 8.9e-101 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155559
AA Change: Y414F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116687
Gene: ENSMUSG00000020614
AA Change: Y414F

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
Pfam:DUF1193 305 525 3.2e-103 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype Strain: 5432376
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a protein that is likely secreted and may function in hematopoiesis. A mutation at this locus has been associated with amelogenesis imperfecta and gingival hyperplasia syndrome. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal ameloblast morphology, disrupted dental enamel formation in both incisor and molar teeth, abnormal kidney morphology, disseminated calcifications of muscular arteries, and intrapulmonary calcifications. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,011,740 I54M Het
Abca4 A G 3: 122,087,477 N514D probably benign Het
Adgre1 G A 17: 57,450,101 R786H probably null Het
Ankrd7 G A 6: 18,868,025 V97I probably damaging Het
Bmper C T 9: 23,406,713 P543S possibly damaging Het
Brwd1 A T 16: 95,993,815 M2233K possibly damaging Het
C1s2 G T 6: 124,625,594 P553T probably damaging Het
Cachd1 G A 4: 100,966,241 V497I possibly damaging Het
Cacng4 A G 11: 107,735,193 S191P probably damaging Het
Cd109 C A 9: 78,698,160 T1015K probably damaging Het
Clstn2 A G 9: 97,457,650 L756P probably damaging Het
Crybg3 A T 16: 59,557,524 D1122E possibly damaging Het
Csf2 A T 11: 54,249,594 L6* probably null Het
Csnk1g2 T A 10: 80,637,911 Y71N possibly damaging Het
Dlg2 C A 7: 90,915,523 H116N probably benign Het
Dnah14 C T 1: 181,792,045 S3978L probably damaging Het
Dpp8 C T 9: 65,053,171 T328I probably null Het
Dysf T C 6: 84,186,468 V1625A probably damaging Het
Egf C A 3: 129,754,889 V26F probably damaging Het
Fam126a C T 5: 23,991,750 E47K probably benign Het
Fsip2 T C 2: 82,987,897 I4658T probably benign Het
Gm11639 G A 11: 104,893,085 G2754E probably benign Het
Gm21319 T C 12: 87,773,756 N11S possibly damaging Het
Igflr1 A T 7: 30,567,228 Q167L possibly damaging Het
Krt79 T G 15: 101,930,761 E424D probably benign Het
Map3k6 A G 4: 133,251,857 probably null Het
Mcpt4 A G 14: 56,060,054 I215T probably damaging Het
Med13 T C 11: 86,299,158 Y975C probably damaging Het
Meioc T A 11: 102,675,593 Y678* probably null Het
Myof T C 19: 37,936,370 T1190A probably benign Het
Nap1l4 A C 7: 143,534,395 probably benign Het
Ncapg T C 5: 45,693,853 V796A probably damaging Het
Olfr1167 T A 2: 88,149,270 I250L probably benign Het
Olfr1168 T A 2: 88,184,916 V13E possibly damaging Het
Olfr1224-ps1 C T 2: 89,156,438 V246M possibly damaging Het
Olfr1257 C T 2: 89,881,612 T262I probably benign Het
Olfr493 T C 7: 108,346,438 Y181C probably benign Het
Paxbp1 A G 16: 91,027,300 S515P probably benign Het
Plce1 C T 19: 38,728,970 S1401F probably damaging Het
Rptor A G 11: 119,887,138 K1043E probably benign Het
Rtn4rl2 T G 2: 84,880,695 N75T probably damaging Het
Slc35f4 A G 14: 49,298,834 I448T possibly damaging Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,301,649 probably benign Het
Tas2r115 A G 6: 132,737,955 I11T possibly damaging Het
Tbc1d5 A G 17: 50,874,652 V351A possibly damaging Het
Tmem55b A G 14: 50,927,979 V257A probably benign Het
Trim43b A T 9: 89,089,517 D195E probably benign Het
Trim65 C A 11: 116,130,738 A90S probably benign Het
Trip11 C T 12: 101,884,506 V1100I possibly damaging Het
Tyrp1 A G 4: 80,840,775 E295G probably null Het
Ube2g2 G A 10: 77,644,473 V138I probably benign Het
Wdr60 T A 12: 116,241,783 probably null Het
Other mutations in Fam20a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Fam20a APN 11 109677762 splice site probably benign
IGL01296:Fam20a APN 11 109685351 missense possibly damaging 0.93
IGL01319:Fam20a APN 11 109678458 splice site probably benign
IGL01322:Fam20a APN 11 109682912 missense probably damaging 1.00
IGL02086:Fam20a APN 11 109673413 missense probably benign 0.00
IGL02563:Fam20a APN 11 109677794 missense possibly damaging 0.53
IGL02883:Fam20a APN 11 109675127 missense probably damaging 0.99
IGL02893:Fam20a APN 11 109721588 missense probably benign 0.00
Infamy UTSW 11 109673342 missense possibly damaging 0.87
snide UTSW 11 109721375 missense possibly damaging 0.92
ungainly UTSW 11 109682870 nonsense probably null
P0026:Fam20a UTSW 11 109675841 critical splice donor site probably null
R0726:Fam20a UTSW 11 109677194 missense probably damaging 1.00
R1317:Fam20a UTSW 11 109677838 missense probably damaging 0.99
R1462:Fam20a UTSW 11 109677317 missense probably damaging 1.00
R1462:Fam20a UTSW 11 109677317 missense probably damaging 1.00
R1751:Fam20a UTSW 11 109677838 missense probably damaging 0.99
R1761:Fam20a UTSW 11 109677838 missense probably damaging 0.99
R1889:Fam20a UTSW 11 109673554 missense probably benign 0.30
R1895:Fam20a UTSW 11 109673554 missense probably benign 0.30
R1971:Fam20a UTSW 11 109685411 missense probably damaging 1.00
R2192:Fam20a UTSW 11 109674623 missense probably benign 0.13
R3745:Fam20a UTSW 11 109677790 missense probably benign 0.17
R4684:Fam20a UTSW 11 109721687 missense unknown
R4835:Fam20a UTSW 11 109673563 missense probably benign 0.40
R5045:Fam20a UTSW 11 109677885 missense probably benign 0.38
R5161:Fam20a UTSW 11 109673370 missense probably benign 0.00
R5715:Fam20a UTSW 11 109678431 missense probably damaging 1.00
R5817:Fam20a UTSW 11 109673418 missense possibly damaging 0.81
R5960:Fam20a UTSW 11 109675969 intron probably benign
R6162:Fam20a UTSW 11 109682870 nonsense probably null
R6312:Fam20a UTSW 11 109674630 missense probably damaging 1.00
R7231:Fam20a UTSW 11 109721375 missense possibly damaging 0.92
R7311:Fam20a UTSW 11 109674628 nonsense probably null
R7366:Fam20a UTSW 11 109673342 missense possibly damaging 0.87
R8013:Fam20a UTSW 11 109685506 missense possibly damaging 0.92
R8014:Fam20a UTSW 11 109685506 missense possibly damaging 0.92
R9086:Fam20a UTSW 11 109675928 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACTGGAGAGTCTGTGCTAC -3'
(R):5'- AGCCCAACAGCTGTGTGTAC -3'

Sequencing Primer
(F):5'- TGCTACTTAGCAAAGGGC -3'
(R):5'- ACAGTTCTGCTCACCAGGCTG -3'
Posted On 2022-11-14