Incidental Mutation 'R9751:Slc35f4'
ID 732536
Institutional Source Beutler Lab
Gene Symbol Slc35f4
Ensembl Gene ENSMUSG00000021852
Gene Name solute carrier family 35, member F4
Synonyms 4930550L21Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.178) question?
Stock # R9751 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 49535976-49763354 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 49536291 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 448 (I448T)
Ref Sequence ENSEMBL: ENSMUSP00000073972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074368] [ENSMUST00000138884]
AlphaFold Q8BZK4
Predicted Effect possibly damaging
Transcript: ENSMUST00000074368
AA Change: I448T

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000073972
Gene: ENSMUSG00000021852
AA Change: I448T

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 160 182 N/A INTRINSIC
Pfam:SLC35F 216 435 7.6e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000138884
AA Change: I298T

PolyPhen 2 Score 0.723 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000119007
Gene: ENSMUSG00000021852
AA Change: I298T

DomainStartEndE-ValueType
Pfam:EmrE 18 143 1e-12 PFAM
Pfam:EamA 57 135 8.4e-9 PFAM
Pfam:DUF914 68 314 4.8e-8 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,881,126 (GRCm39) N514D probably benign Het
Adgre1 G A 17: 57,757,101 (GRCm39) R786H probably null Het
Ankrd7 G A 6: 18,868,024 (GRCm39) V97I probably damaging Het
Bltp1 A G 3: 37,065,889 (GRCm39) I54M Het
Bmper C T 9: 23,318,009 (GRCm39) P543S possibly damaging Het
Brwd1 A T 16: 95,795,015 (GRCm39) M2233K possibly damaging Het
C1s2 G T 6: 124,602,553 (GRCm39) P553T probably damaging Het
Cachd1 G A 4: 100,823,438 (GRCm39) V497I possibly damaging Het
Cacng4 A G 11: 107,626,019 (GRCm39) S191P probably damaging Het
Cd109 C A 9: 78,605,442 (GRCm39) T1015K probably damaging Het
Clstn2 A G 9: 97,339,703 (GRCm39) L756P probably damaging Het
Crybg3 A T 16: 59,377,887 (GRCm39) D1122E possibly damaging Het
Csf2 A T 11: 54,140,420 (GRCm39) L6* probably null Het
Csnk1g2 T A 10: 80,473,745 (GRCm39) Y71N possibly damaging Het
Dlg2 C A 7: 90,564,731 (GRCm39) H116N probably benign Het
Dnah14 C T 1: 181,619,610 (GRCm39) S3978L probably damaging Het
Dpp8 C T 9: 64,960,453 (GRCm39) T328I probably null Het
Dync2i1 T A 12: 116,205,403 (GRCm39) probably null Het
Dysf T C 6: 84,163,450 (GRCm39) V1625A probably damaging Het
Efcab3 G A 11: 104,783,911 (GRCm39) G2754E probably benign Het
Egf C A 3: 129,548,538 (GRCm39) V26F probably damaging Het
Eif1ad19 T C 12: 87,740,526 (GRCm39) N11S possibly damaging Het
Fam20a T A 11: 109,565,992 (GRCm39) Y414F probably damaging Het
Fsip2 T C 2: 82,818,241 (GRCm39) I4658T probably benign Het
Hycc1 C T 5: 24,196,748 (GRCm39) E47K probably benign Het
Igflr1 A T 7: 30,266,653 (GRCm39) Q167L possibly damaging Het
Krt79 T G 15: 101,839,196 (GRCm39) E424D probably benign Het
Map3k6 A G 4: 132,979,168 (GRCm39) probably null Het
Mcpt4 A G 14: 56,297,511 (GRCm39) I215T probably damaging Het
Med13 T C 11: 86,189,984 (GRCm39) Y975C probably damaging Het
Meioc T A 11: 102,566,419 (GRCm39) Y678* probably null Het
Myof T C 19: 37,924,818 (GRCm39) T1190A probably benign Het
Nap1l4 A C 7: 143,088,132 (GRCm39) probably benign Het
Ncapg T C 5: 45,851,195 (GRCm39) V796A probably damaging Het
Or4c10b C T 2: 89,711,956 (GRCm39) T262I probably benign Het
Or4c119 C T 2: 88,986,782 (GRCm39) V246M possibly damaging Het
Or5d39 T A 2: 87,979,614 (GRCm39) I250L probably benign Het
Or5d40 T A 2: 88,015,260 (GRCm39) V13E possibly damaging Het
Or5p68 T C 7: 107,945,645 (GRCm39) Y181C probably benign Het
Paxbp1 A G 16: 90,824,188 (GRCm39) S515P probably benign Het
Pip4p1 A G 14: 51,165,436 (GRCm39) V257A probably benign Het
Plce1 C T 19: 38,717,414 (GRCm39) S1401F probably damaging Het
Rptor A G 11: 119,777,964 (GRCm39) K1043E probably benign Het
Rtn4rl2 T G 2: 84,711,039 (GRCm39) N75T probably damaging Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,278,612 (GRCm39) probably benign Het
Tas2r115 A G 6: 132,714,918 (GRCm39) I11T possibly damaging Het
Tbc1d5 A G 17: 51,181,680 (GRCm39) V351A possibly damaging Het
Trim43b A T 9: 88,971,570 (GRCm39) D195E probably benign Het
Trim65 C A 11: 116,021,564 (GRCm39) A90S probably benign Het
Trip11 C T 12: 101,850,765 (GRCm39) V1100I possibly damaging Het
Tyrp1 A G 4: 80,759,012 (GRCm39) E295G probably null Het
Ube2g2 G A 10: 77,480,307 (GRCm39) V138I probably benign Het
Other mutations in Slc35f4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Slc35f4 APN 14 49,536,334 (GRCm39) missense probably benign 0.15
IGL01640:Slc35f4 APN 14 49,556,225 (GRCm39) missense probably damaging 0.99
IGL01942:Slc35f4 APN 14 49,762,962 (GRCm39) splice site probably benign
IGL01990:Slc35f4 APN 14 49,541,626 (GRCm39) critical splice donor site probably null
IGL02097:Slc35f4 APN 14 49,543,703 (GRCm39) missense probably damaging 1.00
IGL02803:Slc35f4 APN 14 49,541,714 (GRCm39) missense probably benign 0.00
R0005:Slc35f4 UTSW 14 49,559,943 (GRCm39) splice site probably benign
R0238:Slc35f4 UTSW 14 49,541,713 (GRCm39) missense possibly damaging 0.78
R0238:Slc35f4 UTSW 14 49,541,713 (GRCm39) missense possibly damaging 0.78
R0239:Slc35f4 UTSW 14 49,541,713 (GRCm39) missense possibly damaging 0.78
R0239:Slc35f4 UTSW 14 49,541,713 (GRCm39) missense possibly damaging 0.78
R0764:Slc35f4 UTSW 14 49,543,796 (GRCm39) splice site probably benign
R1884:Slc35f4 UTSW 14 49,551,091 (GRCm39) missense probably damaging 1.00
R1916:Slc35f4 UTSW 14 49,541,380 (GRCm39) intron probably benign
R2047:Slc35f4 UTSW 14 49,541,029 (GRCm39) intron probably benign
R2239:Slc35f4 UTSW 14 49,543,660 (GRCm39) critical splice donor site probably null
R2380:Slc35f4 UTSW 14 49,543,660 (GRCm39) critical splice donor site probably null
R4273:Slc35f4 UTSW 14 49,541,758 (GRCm39) missense possibly damaging 0.81
R4420:Slc35f4 UTSW 14 49,551,034 (GRCm39) unclassified probably benign
R4425:Slc35f4 UTSW 14 49,556,307 (GRCm39) missense possibly damaging 0.85
R5261:Slc35f4 UTSW 14 49,540,946 (GRCm39) intron probably benign
R5398:Slc35f4 UTSW 14 49,536,304 (GRCm39) missense probably damaging 1.00
R5402:Slc35f4 UTSW 14 49,556,331 (GRCm39) missense probably damaging 1.00
R6310:Slc35f4 UTSW 14 49,559,914 (GRCm39) missense probably damaging 1.00
R6596:Slc35f4 UTSW 14 49,763,057 (GRCm39) missense probably damaging 1.00
R6729:Slc35f4 UTSW 14 49,556,417 (GRCm39) missense probably benign 0.16
R6864:Slc35f4 UTSW 14 49,556,310 (GRCm39) missense possibly damaging 0.55
R7427:Slc35f4 UTSW 14 49,536,355 (GRCm39) missense probably damaging 0.99
R7428:Slc35f4 UTSW 14 49,536,355 (GRCm39) missense probably damaging 0.99
R7559:Slc35f4 UTSW 14 49,541,732 (GRCm39) missense probably benign 0.03
R7596:Slc35f4 UTSW 14 49,543,666 (GRCm39) missense probably damaging 1.00
R7722:Slc35f4 UTSW 14 49,543,731 (GRCm39) missense probably benign 0.22
R8263:Slc35f4 UTSW 14 49,551,084 (GRCm39) missense probably damaging 1.00
R8525:Slc35f4 UTSW 14 49,541,681 (GRCm39) missense possibly damaging 0.56
R9198:Slc35f4 UTSW 14 49,556,377 (GRCm39) missense unknown
R9615:Slc35f4 UTSW 14 49,556,306 (GRCm39) missense probably benign 0.00
R9772:Slc35f4 UTSW 14 49,551,175 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGAGTTGATAGTGTCATTTGAG -3'
(R):5'- GCGAGACTTGAGATGTAGCC -3'

Sequencing Primer
(F):5'- ATAGTGTCATTTGAGTGTACAGGTAG -3'
(R):5'- TCAGCGAGGTTCCTGTACAGTC -3'
Posted On 2022-11-14