Incidental Mutation 'R9751:Crybg3'
ID 732540
Institutional Source Beutler Lab
Gene Symbol Crybg3
Ensembl Gene ENSMUSG00000022723
Gene Name beta-gamma crystallin domain containing 3
Synonyms Gm9581
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.138) question?
Stock # R9751 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 59312451-59421410 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 59377887 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1122 (D1122E)
Ref Sequence ENSEMBL: ENSMUSP00000156047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044604] [ENSMUST00000172910]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000044604
SMART Domains Protein: ENSMUSP00000037682
Gene: ENSMUSG00000022723

DomainStartEndE-ValueType
low complexity region 258 273 N/A INTRINSIC
low complexity region 282 290 N/A INTRINSIC
XTALbg 430 516 2.78e-4 SMART
Pfam:Crystall 536 599 3.3e-7 PFAM
XTALbg 614 699 1.2e-21 SMART
XTALbg 707 790 5.73e-19 SMART
XTALbg 803 881 6.87e-5 SMART
XTALbg 889 969 1.28e-7 SMART
RICIN 972 1104 8.16e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000172910
AA Change: D1122E

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,881,126 (GRCm39) N514D probably benign Het
Adgre1 G A 17: 57,757,101 (GRCm39) R786H probably null Het
Ankrd7 G A 6: 18,868,024 (GRCm39) V97I probably damaging Het
Bltp1 A G 3: 37,065,889 (GRCm39) I54M Het
Bmper C T 9: 23,318,009 (GRCm39) P543S possibly damaging Het
Brwd1 A T 16: 95,795,015 (GRCm39) M2233K possibly damaging Het
C1s2 G T 6: 124,602,553 (GRCm39) P553T probably damaging Het
Cachd1 G A 4: 100,823,438 (GRCm39) V497I possibly damaging Het
Cacng4 A G 11: 107,626,019 (GRCm39) S191P probably damaging Het
Cd109 C A 9: 78,605,442 (GRCm39) T1015K probably damaging Het
Clstn2 A G 9: 97,339,703 (GRCm39) L756P probably damaging Het
Csf2 A T 11: 54,140,420 (GRCm39) L6* probably null Het
Csnk1g2 T A 10: 80,473,745 (GRCm39) Y71N possibly damaging Het
Dlg2 C A 7: 90,564,731 (GRCm39) H116N probably benign Het
Dnah14 C T 1: 181,619,610 (GRCm39) S3978L probably damaging Het
Dpp8 C T 9: 64,960,453 (GRCm39) T328I probably null Het
Dync2i1 T A 12: 116,205,403 (GRCm39) probably null Het
Dysf T C 6: 84,163,450 (GRCm39) V1625A probably damaging Het
Efcab3 G A 11: 104,783,911 (GRCm39) G2754E probably benign Het
Egf C A 3: 129,548,538 (GRCm39) V26F probably damaging Het
Eif1ad19 T C 12: 87,740,526 (GRCm39) N11S possibly damaging Het
Fam20a T A 11: 109,565,992 (GRCm39) Y414F probably damaging Het
Fsip2 T C 2: 82,818,241 (GRCm39) I4658T probably benign Het
Hycc1 C T 5: 24,196,748 (GRCm39) E47K probably benign Het
Igflr1 A T 7: 30,266,653 (GRCm39) Q167L possibly damaging Het
Krt79 T G 15: 101,839,196 (GRCm39) E424D probably benign Het
Map3k6 A G 4: 132,979,168 (GRCm39) probably null Het
Mcpt4 A G 14: 56,297,511 (GRCm39) I215T probably damaging Het
Med13 T C 11: 86,189,984 (GRCm39) Y975C probably damaging Het
Meioc T A 11: 102,566,419 (GRCm39) Y678* probably null Het
Myof T C 19: 37,924,818 (GRCm39) T1190A probably benign Het
Nap1l4 A C 7: 143,088,132 (GRCm39) probably benign Het
Ncapg T C 5: 45,851,195 (GRCm39) V796A probably damaging Het
Or4c10b C T 2: 89,711,956 (GRCm39) T262I probably benign Het
Or4c119 C T 2: 88,986,782 (GRCm39) V246M possibly damaging Het
Or5d39 T A 2: 87,979,614 (GRCm39) I250L probably benign Het
Or5d40 T A 2: 88,015,260 (GRCm39) V13E possibly damaging Het
Or5p68 T C 7: 107,945,645 (GRCm39) Y181C probably benign Het
Paxbp1 A G 16: 90,824,188 (GRCm39) S515P probably benign Het
Pip4p1 A G 14: 51,165,436 (GRCm39) V257A probably benign Het
Plce1 C T 19: 38,717,414 (GRCm39) S1401F probably damaging Het
Rptor A G 11: 119,777,964 (GRCm39) K1043E probably benign Het
Rtn4rl2 T G 2: 84,711,039 (GRCm39) N75T probably damaging Het
Slc35f4 A G 14: 49,536,291 (GRCm39) I448T possibly damaging Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,278,612 (GRCm39) probably benign Het
Tas2r115 A G 6: 132,714,918 (GRCm39) I11T possibly damaging Het
Tbc1d5 A G 17: 51,181,680 (GRCm39) V351A possibly damaging Het
Trim43b A T 9: 88,971,570 (GRCm39) D195E probably benign Het
Trim65 C A 11: 116,021,564 (GRCm39) A90S probably benign Het
Trip11 C T 12: 101,850,765 (GRCm39) V1100I possibly damaging Het
Tyrp1 A G 4: 80,759,012 (GRCm39) E295G probably null Het
Ube2g2 G A 10: 77,480,307 (GRCm39) V138I probably benign Het
Other mutations in Crybg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Crybg3 APN 16 59,350,803 (GRCm39) missense probably benign 0.15
IGL01305:Crybg3 APN 16 59,349,590 (GRCm39) missense probably damaging 1.00
IGL01809:Crybg3 APN 16 59,345,216 (GRCm39) critical splice donor site probably benign 0.00
IGL02247:Crybg3 APN 16 59,323,513 (GRCm39) missense probably damaging 1.00
IGL02252:Crybg3 APN 16 59,372,887 (GRCm39) splice site probably benign
IGL03036:Crybg3 APN 16 59,375,542 (GRCm39) missense possibly damaging 0.68
IGL03202:Crybg3 APN 16 59,315,072 (GRCm39) missense probably damaging 1.00
IGL03232:Crybg3 APN 16 59,350,731 (GRCm39) missense probably damaging 1.00
ANU22:Crybg3 UTSW 16 59,349,590 (GRCm39) missense probably damaging 1.00
R0052:Crybg3 UTSW 16 59,386,019 (GRCm39) splice site probably benign
R0335:Crybg3 UTSW 16 59,364,503 (GRCm39) missense probably damaging 1.00
R0691:Crybg3 UTSW 16 59,385,574 (GRCm39) critical splice donor site probably null
R1511:Crybg3 UTSW 16 59,374,475 (GRCm39) missense probably benign 0.01
R1579:Crybg3 UTSW 16 59,350,561 (GRCm39) missense probably damaging 1.00
R1965:Crybg3 UTSW 16 59,323,600 (GRCm39) missense probably damaging 1.00
R1982:Crybg3 UTSW 16 59,364,488 (GRCm39) missense possibly damaging 0.85
R2225:Crybg3 UTSW 16 59,375,041 (GRCm39) missense probably damaging 1.00
R4074:Crybg3 UTSW 16 59,376,120 (GRCm39) unclassified probably benign
R4210:Crybg3 UTSW 16 59,364,414 (GRCm39) missense probably damaging 1.00
R4393:Crybg3 UTSW 16 59,380,458 (GRCm39) unclassified probably benign
R4394:Crybg3 UTSW 16 59,380,458 (GRCm39) unclassified probably benign
R4397:Crybg3 UTSW 16 59,380,458 (GRCm39) unclassified probably benign
R4427:Crybg3 UTSW 16 59,363,562 (GRCm39) missense probably damaging 1.00
R4578:Crybg3 UTSW 16 59,350,564 (GRCm39) missense probably damaging 1.00
R4720:Crybg3 UTSW 16 59,360,180 (GRCm39) missense probably damaging 1.00
R4917:Crybg3 UTSW 16 59,350,782 (GRCm39) missense probably benign 0.14
R5007:Crybg3 UTSW 16 59,378,463 (GRCm39) unclassified probably benign
R5020:Crybg3 UTSW 16 59,375,159 (GRCm39) missense possibly damaging 0.55
R5155:Crybg3 UTSW 16 59,345,264 (GRCm39) missense possibly damaging 0.91
R5306:Crybg3 UTSW 16 59,380,356 (GRCm39) unclassified probably benign
R5342:Crybg3 UTSW 16 59,342,512 (GRCm39) missense probably damaging 1.00
R5687:Crybg3 UTSW 16 59,379,529 (GRCm39) missense probably benign 0.00
R5763:Crybg3 UTSW 16 59,374,973 (GRCm39) missense possibly damaging 0.74
R5860:Crybg3 UTSW 16 59,385,632 (GRCm39) missense probably damaging 1.00
R5950:Crybg3 UTSW 16 59,313,934 (GRCm39) unclassified probably benign
R6007:Crybg3 UTSW 16 59,374,837 (GRCm39) nonsense probably null
R6042:Crybg3 UTSW 16 59,370,838 (GRCm39) missense possibly damaging 0.70
R6049:Crybg3 UTSW 16 59,364,417 (GRCm39) missense probably benign 0.00
R6242:Crybg3 UTSW 16 59,376,053 (GRCm39) missense probably benign
R6301:Crybg3 UTSW 16 59,350,701 (GRCm39) missense probably damaging 1.00
R6408:Crybg3 UTSW 16 59,316,053 (GRCm39) missense possibly damaging 0.71
R6724:Crybg3 UTSW 16 59,364,501 (GRCm39) missense probably benign 0.13
R6745:Crybg3 UTSW 16 59,372,607 (GRCm39) missense possibly damaging 0.93
R6777:Crybg3 UTSW 16 59,378,678 (GRCm39) unclassified probably benign
R6843:Crybg3 UTSW 16 59,380,159 (GRCm39) missense probably benign 0.22
R6914:Crybg3 UTSW 16 59,360,183 (GRCm39) missense possibly damaging 0.89
R6942:Crybg3 UTSW 16 59,360,183 (GRCm39) missense possibly damaging 0.89
R7033:Crybg3 UTSW 16 59,374,528 (GRCm39) missense probably damaging 1.00
R7091:Crybg3 UTSW 16 59,377,531 (GRCm39) missense possibly damaging 0.77
R7133:Crybg3 UTSW 16 59,357,167 (GRCm39) missense probably damaging 1.00
R7193:Crybg3 UTSW 16 59,379,956 (GRCm39) missense possibly damaging 0.87
R7204:Crybg3 UTSW 16 59,379,253 (GRCm39) missense probably benign 0.00
R7398:Crybg3 UTSW 16 59,377,688 (GRCm39) missense probably benign 0.38
R7666:Crybg3 UTSW 16 59,379,700 (GRCm39) nonsense probably null
R7691:Crybg3 UTSW 16 59,376,497 (GRCm39) missense not run
R7714:Crybg3 UTSW 16 59,379,236 (GRCm39) missense probably benign 0.19
R7860:Crybg3 UTSW 16 59,375,605 (GRCm39) missense probably benign 0.04
R7901:Crybg3 UTSW 16 59,377,907 (GRCm39) missense probably damaging 0.98
R8371:Crybg3 UTSW 16 59,377,414 (GRCm39) missense probably benign 0.00
R8394:Crybg3 UTSW 16 59,378,651 (GRCm39) missense probably benign 0.06
R8438:Crybg3 UTSW 16 59,385,655 (GRCm39) missense probably benign 0.02
R8529:Crybg3 UTSW 16 59,376,984 (GRCm39) missense probably damaging 0.98
R8699:Crybg3 UTSW 16 59,375,291 (GRCm39) missense probably damaging 1.00
R8766:Crybg3 UTSW 16 59,375,696 (GRCm39) missense probably benign 0.05
R8767:Crybg3 UTSW 16 59,376,500 (GRCm39) missense probably benign
R8789:Crybg3 UTSW 16 59,375,359 (GRCm39) missense probably benign 0.00
R8871:Crybg3 UTSW 16 59,378,519 (GRCm39) missense probably benign
R8878:Crybg3 UTSW 16 59,380,547 (GRCm39) missense probably benign 0.09
R8894:Crybg3 UTSW 16 59,342,552 (GRCm39) missense probably damaging 0.97
R8928:Crybg3 UTSW 16 59,376,715 (GRCm39) missense probably benign 0.40
R8928:Crybg3 UTSW 16 59,315,123 (GRCm39) missense probably benign 0.31
R8939:Crybg3 UTSW 16 59,376,512 (GRCm39) missense probably benign 0.00
R9010:Crybg3 UTSW 16 59,374,702 (GRCm39) missense probably damaging 0.98
R9266:Crybg3 UTSW 16 59,372,544 (GRCm39) missense probably damaging 0.99
R9348:Crybg3 UTSW 16 59,421,256 (GRCm39) start codon destroyed probably null 0.66
R9353:Crybg3 UTSW 16 59,421,107 (GRCm39) critical splice donor site probably null
R9406:Crybg3 UTSW 16 59,378,839 (GRCm39) missense probably benign 0.42
R9429:Crybg3 UTSW 16 59,375,556 (GRCm39) missense probably benign 0.08
R9464:Crybg3 UTSW 16 59,376,120 (GRCm39) unclassified probably benign
R9621:Crybg3 UTSW 16 59,326,613 (GRCm39) missense possibly damaging 0.73
R9703:Crybg3 UTSW 16 59,375,939 (GRCm39) missense probably damaging 0.96
R9766:Crybg3 UTSW 16 59,376,207 (GRCm39) missense probably benign 0.03
RF007:Crybg3 UTSW 16 59,377,067 (GRCm39) missense possibly damaging 0.94
Z1177:Crybg3 UTSW 16 59,376,841 (GRCm39) missense probably benign 0.09
Z1177:Crybg3 UTSW 16 59,375,756 (GRCm39) nonsense probably null
Z1187:Crybg3 UTSW 16 59,326,608 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCAGTCAATGTATCAGCTC -3'
(R):5'- AGAGCACAGCTGTAAATTCACATG -3'

Sequencing Primer
(F):5'- GTATCAGCTCTTTTGGGTAAACC -3'
(R):5'- GCTGTAAATTCACATGATCTCCCAAG -3'
Posted On 2022-11-14