Incidental Mutation 'R9751:Tbc1d5'
ID 732543
Institutional Source Beutler Lab
Gene Symbol Tbc1d5
Ensembl Gene ENSMUSG00000023923
Gene Name TBC1 domain family, member 5
Synonyms 1600014N05Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9751 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 51040152-51486380 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 51181680 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 351 (V351A)
Ref Sequence ENSEMBL: ENSMUSP00000024717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024717] [ENSMUST00000224528]
AlphaFold Q80XQ2
Predicted Effect possibly damaging
Transcript: ENSMUST00000024717
AA Change: V351A

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000024717
Gene: ENSMUSG00000023923
AA Change: V351A

DomainStartEndE-ValueType
TBC 78 384 5.56e-86 SMART
low complexity region 475 492 N/A INTRINSIC
SCOP:d1lsha3 511 546 1e-3 SMART
low complexity region 556 568 N/A INTRINSIC
low complexity region 783 802 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000224528
AA Change: V351A

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,881,126 (GRCm39) N514D probably benign Het
Adgre1 G A 17: 57,757,101 (GRCm39) R786H probably null Het
Ankrd7 G A 6: 18,868,024 (GRCm39) V97I probably damaging Het
Bltp1 A G 3: 37,065,889 (GRCm39) I54M Het
Bmper C T 9: 23,318,009 (GRCm39) P543S possibly damaging Het
Brwd1 A T 16: 95,795,015 (GRCm39) M2233K possibly damaging Het
C1s2 G T 6: 124,602,553 (GRCm39) P553T probably damaging Het
Cachd1 G A 4: 100,823,438 (GRCm39) V497I possibly damaging Het
Cacng4 A G 11: 107,626,019 (GRCm39) S191P probably damaging Het
Cd109 C A 9: 78,605,442 (GRCm39) T1015K probably damaging Het
Clstn2 A G 9: 97,339,703 (GRCm39) L756P probably damaging Het
Crybg3 A T 16: 59,377,887 (GRCm39) D1122E possibly damaging Het
Csf2 A T 11: 54,140,420 (GRCm39) L6* probably null Het
Csnk1g2 T A 10: 80,473,745 (GRCm39) Y71N possibly damaging Het
Dlg2 C A 7: 90,564,731 (GRCm39) H116N probably benign Het
Dnah14 C T 1: 181,619,610 (GRCm39) S3978L probably damaging Het
Dpp8 C T 9: 64,960,453 (GRCm39) T328I probably null Het
Dync2i1 T A 12: 116,205,403 (GRCm39) probably null Het
Dysf T C 6: 84,163,450 (GRCm39) V1625A probably damaging Het
Efcab3 G A 11: 104,783,911 (GRCm39) G2754E probably benign Het
Egf C A 3: 129,548,538 (GRCm39) V26F probably damaging Het
Eif1ad19 T C 12: 87,740,526 (GRCm39) N11S possibly damaging Het
Fam20a T A 11: 109,565,992 (GRCm39) Y414F probably damaging Het
Fsip2 T C 2: 82,818,241 (GRCm39) I4658T probably benign Het
Hycc1 C T 5: 24,196,748 (GRCm39) E47K probably benign Het
Igflr1 A T 7: 30,266,653 (GRCm39) Q167L possibly damaging Het
Krt79 T G 15: 101,839,196 (GRCm39) E424D probably benign Het
Map3k6 A G 4: 132,979,168 (GRCm39) probably null Het
Mcpt4 A G 14: 56,297,511 (GRCm39) I215T probably damaging Het
Med13 T C 11: 86,189,984 (GRCm39) Y975C probably damaging Het
Meioc T A 11: 102,566,419 (GRCm39) Y678* probably null Het
Myof T C 19: 37,924,818 (GRCm39) T1190A probably benign Het
Nap1l4 A C 7: 143,088,132 (GRCm39) probably benign Het
Ncapg T C 5: 45,851,195 (GRCm39) V796A probably damaging Het
Or4c10b C T 2: 89,711,956 (GRCm39) T262I probably benign Het
Or4c119 C T 2: 88,986,782 (GRCm39) V246M possibly damaging Het
Or5d39 T A 2: 87,979,614 (GRCm39) I250L probably benign Het
Or5d40 T A 2: 88,015,260 (GRCm39) V13E possibly damaging Het
Or5p68 T C 7: 107,945,645 (GRCm39) Y181C probably benign Het
Paxbp1 A G 16: 90,824,188 (GRCm39) S515P probably benign Het
Pip4p1 A G 14: 51,165,436 (GRCm39) V257A probably benign Het
Plce1 C T 19: 38,717,414 (GRCm39) S1401F probably damaging Het
Rptor A G 11: 119,777,964 (GRCm39) K1043E probably benign Het
Rtn4rl2 T G 2: 84,711,039 (GRCm39) N75T probably damaging Het
Slc35f4 A G 14: 49,536,291 (GRCm39) I448T possibly damaging Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,278,612 (GRCm39) probably benign Het
Tas2r115 A G 6: 132,714,918 (GRCm39) I11T possibly damaging Het
Trim43b A T 9: 88,971,570 (GRCm39) D195E probably benign Het
Trim65 C A 11: 116,021,564 (GRCm39) A90S probably benign Het
Trip11 C T 12: 101,850,765 (GRCm39) V1100I possibly damaging Het
Tyrp1 A G 4: 80,759,012 (GRCm39) E295G probably null Het
Ube2g2 G A 10: 77,480,307 (GRCm39) V138I probably benign Het
Other mutations in Tbc1d5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Tbc1d5 APN 17 51,120,826 (GRCm39) missense possibly damaging 0.52
IGL01370:Tbc1d5 APN 17 51,273,755 (GRCm39) missense probably benign 0.18
IGL01625:Tbc1d5 APN 17 51,224,601 (GRCm39) missense probably benign 0.27
IGL01935:Tbc1d5 APN 17 51,270,793 (GRCm39) splice site probably benign
IGL02229:Tbc1d5 APN 17 51,159,628 (GRCm39) missense probably damaging 1.00
IGL02811:Tbc1d5 APN 17 51,107,149 (GRCm39) missense probably damaging 0.99
IGL03192:Tbc1d5 APN 17 51,291,709 (GRCm39) splice site probably benign
FR4976:Tbc1d5 UTSW 17 51,106,971 (GRCm39) missense probably benign 0.01
FR4976:Tbc1d5 UTSW 17 51,106,959 (GRCm39) missense probably benign
IGL02796:Tbc1d5 UTSW 17 51,273,652 (GRCm39) missense probably damaging 1.00
R0153:Tbc1d5 UTSW 17 51,291,715 (GRCm39) splice site probably benign
R0326:Tbc1d5 UTSW 17 51,273,764 (GRCm39) missense probably damaging 1.00
R0417:Tbc1d5 UTSW 17 51,063,733 (GRCm39) missense probably benign 0.18
R0481:Tbc1d5 UTSW 17 51,226,079 (GRCm39) missense probably damaging 0.98
R1143:Tbc1d5 UTSW 17 51,049,087 (GRCm39) nonsense probably null
R1533:Tbc1d5 UTSW 17 51,227,603 (GRCm39) missense possibly damaging 0.89
R1543:Tbc1d5 UTSW 17 51,242,560 (GRCm39) missense probably benign 0.32
R2888:Tbc1d5 UTSW 17 51,242,577 (GRCm39) missense probably damaging 1.00
R3153:Tbc1d5 UTSW 17 51,275,264 (GRCm39) missense probably damaging 1.00
R3430:Tbc1d5 UTSW 17 51,107,156 (GRCm39) missense probably damaging 1.00
R3898:Tbc1d5 UTSW 17 51,270,772 (GRCm39) missense probably damaging 0.98
R4116:Tbc1d5 UTSW 17 51,227,615 (GRCm39) missense probably damaging 1.00
R4352:Tbc1d5 UTSW 17 51,089,429 (GRCm39) missense probably damaging 0.98
R4456:Tbc1d5 UTSW 17 51,089,369 (GRCm39) missense probably damaging 1.00
R4648:Tbc1d5 UTSW 17 51,043,251 (GRCm39) missense probably benign
R4711:Tbc1d5 UTSW 17 51,242,537 (GRCm39) missense probably damaging 0.98
R4754:Tbc1d5 UTSW 17 51,107,193 (GRCm39) missense probably benign 0.03
R5303:Tbc1d5 UTSW 17 51,043,228 (GRCm39) missense probably benign 0.00
R5360:Tbc1d5 UTSW 17 51,291,660 (GRCm39) missense probably benign 0.26
R5443:Tbc1d5 UTSW 17 51,042,995 (GRCm39) missense probably damaging 0.98
R5444:Tbc1d5 UTSW 17 51,042,995 (GRCm39) missense probably damaging 0.98
R5611:Tbc1d5 UTSW 17 51,042,995 (GRCm39) missense probably damaging 0.98
R5658:Tbc1d5 UTSW 17 51,120,869 (GRCm39) missense probably benign 0.18
R5701:Tbc1d5 UTSW 17 51,106,983 (GRCm39) small deletion probably benign
R5921:Tbc1d5 UTSW 17 51,270,721 (GRCm39) missense probably damaging 1.00
R6280:Tbc1d5 UTSW 17 51,089,338 (GRCm39) missense probably benign 0.01
R6628:Tbc1d5 UTSW 17 51,043,236 (GRCm39) missense probably benign
R6705:Tbc1d5 UTSW 17 51,332,203 (GRCm39) start gained probably benign
R6990:Tbc1d5 UTSW 17 51,275,260 (GRCm39) missense probably benign 0.19
R7184:Tbc1d5 UTSW 17 51,107,110 (GRCm39) missense probably benign 0.00
R7443:Tbc1d5 UTSW 17 51,273,763 (GRCm39) missense probably damaging 1.00
R7484:Tbc1d5 UTSW 17 51,224,573 (GRCm39) missense possibly damaging 0.68
R7696:Tbc1d5 UTSW 17 51,181,605 (GRCm39) missense probably damaging 1.00
R7787:Tbc1d5 UTSW 17 51,181,711 (GRCm39) nonsense probably null
R7827:Tbc1d5 UTSW 17 51,089,291 (GRCm39) missense probably damaging 0.99
R7841:Tbc1d5 UTSW 17 51,106,950 (GRCm39) small deletion probably benign
R7861:Tbc1d5 UTSW 17 51,063,720 (GRCm39) missense probably damaging 0.99
R7931:Tbc1d5 UTSW 17 51,106,892 (GRCm39) splice site probably benign
R8108:Tbc1d5 UTSW 17 51,049,114 (GRCm39) missense probably benign 0.01
R8434:Tbc1d5 UTSW 17 51,089,455 (GRCm39) splice site probably benign
R8683:Tbc1d5 UTSW 17 51,291,631 (GRCm39) critical splice donor site probably null
R8792:Tbc1d5 UTSW 17 51,106,962 (GRCm39) small insertion probably benign
R8799:Tbc1d5 UTSW 17 51,106,969 (GRCm39) small insertion probably benign
R8799:Tbc1d5 UTSW 17 51,106,963 (GRCm39) small insertion probably benign
R8799:Tbc1d5 UTSW 17 51,106,962 (GRCm39) small insertion probably benign
R8799:Tbc1d5 UTSW 17 51,106,978 (GRCm39) small insertion probably benign
R8848:Tbc1d5 UTSW 17 51,226,082 (GRCm39) missense probably damaging 1.00
R9027:Tbc1d5 UTSW 17 51,063,692 (GRCm39) missense probably damaging 0.97
R9176:Tbc1d5 UTSW 17 51,089,363 (GRCm39) missense probably benign
Z1088:Tbc1d5 UTSW 17 51,270,724 (GRCm39) missense probably damaging 1.00
Z1177:Tbc1d5 UTSW 17 51,273,581 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTGATTTCCTCTGACATTTCATAC -3'
(R):5'- TGCTTTGACACATGATGCTTCC -3'

Sequencing Primer
(F):5'- TCCTCTGACATTTCATACATTTTCTG -3'
(R):5'- GAGGAAAGGATCACTCTCAG -3'
Posted On 2022-11-14