Incidental Mutation 'R9751:Myof'
ID 732545
Institutional Source Beutler Lab
Gene Symbol Myof
Ensembl Gene ENSMUSG00000048612
Gene Name myoferlin
Synonyms E030042N20Rik, 2310051D19Rik, Fer1l3
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9751 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 37887484-38032025 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37924818 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1190 (T1190A)
Ref Sequence ENSEMBL: ENSMUSP00000045036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041475] [ENSMUST00000172095] [ENSMUST00000225159] [ENSMUST00000226068]
AlphaFold Q69ZN7
Predicted Effect probably benign
Transcript: ENSMUST00000041475
AA Change: T1190A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045036
Gene: ENSMUSG00000048612
AA Change: T1190A

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1425 1436 N/A INTRINSIC
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
Pfam:Ferlin_C 1939 2043 2.4e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172095
AA Change: T1190A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129792
Gene: ENSMUSG00000048612
AA Change: T1190A

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
transmembrane domain 2013 2035 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000225159
AA Change: T674A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000226068
AA Change: T1203A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the ferlin family of proteins, which have been implicated in fusion events in muscle tissue. Members of this family have a carboxy-terminal single pass transmembrane domain and multiple C2 domains, which bind negatively charged phospholipids in the presence of calcium ions. This gene is expressed at high levels in myoblasts and upregulated in damaged skeletal muscle. Mice deficient in this protein display defects in myoblast fusion, muscle regeneration, and angiogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body size, impaired myogenesis, lack of large diameter myofibers, abnormal skeletal muscle regeneration after injury, and decreased vascular permeability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,881,126 (GRCm39) N514D probably benign Het
Adgre1 G A 17: 57,757,101 (GRCm39) R786H probably null Het
Ankrd7 G A 6: 18,868,024 (GRCm39) V97I probably damaging Het
Bltp1 A G 3: 37,065,889 (GRCm39) I54M Het
Bmper C T 9: 23,318,009 (GRCm39) P543S possibly damaging Het
Brwd1 A T 16: 95,795,015 (GRCm39) M2233K possibly damaging Het
C1s2 G T 6: 124,602,553 (GRCm39) P553T probably damaging Het
Cachd1 G A 4: 100,823,438 (GRCm39) V497I possibly damaging Het
Cacng4 A G 11: 107,626,019 (GRCm39) S191P probably damaging Het
Cd109 C A 9: 78,605,442 (GRCm39) T1015K probably damaging Het
Clstn2 A G 9: 97,339,703 (GRCm39) L756P probably damaging Het
Crybg3 A T 16: 59,377,887 (GRCm39) D1122E possibly damaging Het
Csf2 A T 11: 54,140,420 (GRCm39) L6* probably null Het
Csnk1g2 T A 10: 80,473,745 (GRCm39) Y71N possibly damaging Het
Dlg2 C A 7: 90,564,731 (GRCm39) H116N probably benign Het
Dnah14 C T 1: 181,619,610 (GRCm39) S3978L probably damaging Het
Dpp8 C T 9: 64,960,453 (GRCm39) T328I probably null Het
Dync2i1 T A 12: 116,205,403 (GRCm39) probably null Het
Dysf T C 6: 84,163,450 (GRCm39) V1625A probably damaging Het
Efcab3 G A 11: 104,783,911 (GRCm39) G2754E probably benign Het
Egf C A 3: 129,548,538 (GRCm39) V26F probably damaging Het
Eif1ad19 T C 12: 87,740,526 (GRCm39) N11S possibly damaging Het
Fam20a T A 11: 109,565,992 (GRCm39) Y414F probably damaging Het
Fsip2 T C 2: 82,818,241 (GRCm39) I4658T probably benign Het
Hycc1 C T 5: 24,196,748 (GRCm39) E47K probably benign Het
Igflr1 A T 7: 30,266,653 (GRCm39) Q167L possibly damaging Het
Krt79 T G 15: 101,839,196 (GRCm39) E424D probably benign Het
Map3k6 A G 4: 132,979,168 (GRCm39) probably null Het
Mcpt4 A G 14: 56,297,511 (GRCm39) I215T probably damaging Het
Med13 T C 11: 86,189,984 (GRCm39) Y975C probably damaging Het
Meioc T A 11: 102,566,419 (GRCm39) Y678* probably null Het
Nap1l4 A C 7: 143,088,132 (GRCm39) probably benign Het
Ncapg T C 5: 45,851,195 (GRCm39) V796A probably damaging Het
Or4c10b C T 2: 89,711,956 (GRCm39) T262I probably benign Het
Or4c119 C T 2: 88,986,782 (GRCm39) V246M possibly damaging Het
Or5d39 T A 2: 87,979,614 (GRCm39) I250L probably benign Het
Or5d40 T A 2: 88,015,260 (GRCm39) V13E possibly damaging Het
Or5p68 T C 7: 107,945,645 (GRCm39) Y181C probably benign Het
Paxbp1 A G 16: 90,824,188 (GRCm39) S515P probably benign Het
Pip4p1 A G 14: 51,165,436 (GRCm39) V257A probably benign Het
Plce1 C T 19: 38,717,414 (GRCm39) S1401F probably damaging Het
Rptor A G 11: 119,777,964 (GRCm39) K1043E probably benign Het
Rtn4rl2 T G 2: 84,711,039 (GRCm39) N75T probably damaging Het
Slc35f4 A G 14: 49,536,291 (GRCm39) I448T possibly damaging Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,278,612 (GRCm39) probably benign Het
Tas2r115 A G 6: 132,714,918 (GRCm39) I11T possibly damaging Het
Tbc1d5 A G 17: 51,181,680 (GRCm39) V351A possibly damaging Het
Trim43b A T 9: 88,971,570 (GRCm39) D195E probably benign Het
Trim65 C A 11: 116,021,564 (GRCm39) A90S probably benign Het
Trip11 C T 12: 101,850,765 (GRCm39) V1100I possibly damaging Het
Tyrp1 A G 4: 80,759,012 (GRCm39) E295G probably null Het
Ube2g2 G A 10: 77,480,307 (GRCm39) V138I probably benign Het
Other mutations in Myof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Myof APN 19 37,949,382 (GRCm39) missense probably benign 0.16
IGL00764:Myof APN 19 37,963,371 (GRCm39) missense probably benign 0.04
IGL00801:Myof APN 19 37,974,521 (GRCm39) missense probably damaging 0.99
IGL01084:Myof APN 19 37,924,884 (GRCm39) missense probably damaging 1.00
IGL01368:Myof APN 19 37,924,905 (GRCm39) missense probably damaging 0.97
IGL01472:Myof APN 19 37,911,524 (GRCm39) missense probably benign
IGL01785:Myof APN 19 37,968,871 (GRCm39) nonsense probably null
IGL02205:Myof APN 19 37,913,083 (GRCm39) missense probably damaging 1.00
IGL02268:Myof APN 19 37,963,311 (GRCm39) missense possibly damaging 0.90
IGL02268:Myof APN 19 37,942,877 (GRCm39) missense possibly damaging 0.50
IGL02339:Myof APN 19 37,960,661 (GRCm39) missense possibly damaging 0.46
IGL02433:Myof APN 19 37,960,641 (GRCm39) missense probably benign 0.05
IGL02481:Myof APN 19 37,926,361 (GRCm39) nonsense probably null
IGL02536:Myof APN 19 37,938,103 (GRCm39) missense probably damaging 0.97
IGL02682:Myof APN 19 37,909,929 (GRCm39) missense probably benign 0.09
IGL02732:Myof APN 19 37,966,164 (GRCm39) missense possibly damaging 0.50
IGL02887:Myof APN 19 37,909,227 (GRCm39) critical splice acceptor site probably null
IGL03114:Myof APN 19 37,892,309 (GRCm39) missense probably damaging 1.00
IGL03137:Myof APN 19 37,963,337 (GRCm39) missense probably damaging 1.00
IGL03340:Myof APN 19 37,899,607 (GRCm39) missense probably damaging 1.00
PIT4791001:Myof UTSW 19 37,971,406 (GRCm39) critical splice donor site probably null
R0024:Myof UTSW 19 37,904,188 (GRCm39) missense probably damaging 0.98
R0140:Myof UTSW 19 37,940,004 (GRCm39) nonsense probably null
R0309:Myof UTSW 19 37,969,714 (GRCm39) missense probably benign 0.12
R0330:Myof UTSW 19 37,924,326 (GRCm39) missense probably damaging 1.00
R0345:Myof UTSW 19 38,012,793 (GRCm39) missense probably damaging 1.00
R0349:Myof UTSW 19 37,899,417 (GRCm39) missense probably damaging 0.99
R0463:Myof UTSW 19 37,904,952 (GRCm39) missense probably damaging 1.00
R0507:Myof UTSW 19 37,889,725 (GRCm39) missense possibly damaging 0.94
R0512:Myof UTSW 19 37,942,972 (GRCm39) missense possibly damaging 0.54
R0608:Myof UTSW 19 37,904,952 (GRCm39) missense probably damaging 1.00
R0723:Myof UTSW 19 37,969,708 (GRCm39) missense probably damaging 1.00
R1081:Myof UTSW 19 37,974,536 (GRCm39) missense probably damaging 0.99
R1196:Myof UTSW 19 37,899,408 (GRCm39) missense probably damaging 1.00
R1243:Myof UTSW 19 37,924,540 (GRCm39) missense probably damaging 1.00
R1371:Myof UTSW 19 37,892,116 (GRCm39) splice site probably benign
R1381:Myof UTSW 19 37,983,933 (GRCm39) missense probably damaging 1.00
R1419:Myof UTSW 19 37,890,359 (GRCm39) missense probably damaging 1.00
R1527:Myof UTSW 19 37,913,067 (GRCm39) missense probably damaging 1.00
R1672:Myof UTSW 19 37,931,927 (GRCm39) missense probably damaging 1.00
R1864:Myof UTSW 19 37,975,153 (GRCm39) missense probably benign
R1914:Myof UTSW 19 37,966,141 (GRCm39) missense probably damaging 1.00
R1915:Myof UTSW 19 37,966,141 (GRCm39) missense probably damaging 1.00
R1970:Myof UTSW 19 37,934,082 (GRCm39) missense probably damaging 0.99
R2062:Myof UTSW 19 37,904,194 (GRCm39) missense possibly damaging 0.94
R2144:Myof UTSW 19 37,969,669 (GRCm39) critical splice donor site probably null
R2243:Myof UTSW 19 37,889,767 (GRCm39) missense probably damaging 1.00
R2339:Myof UTSW 19 37,926,375 (GRCm39) missense probably damaging 1.00
R2484:Myof UTSW 19 37,892,291 (GRCm39) missense probably benign 0.13
R2880:Myof UTSW 19 37,911,473 (GRCm39) missense probably benign 0.04
R3418:Myof UTSW 19 37,911,426 (GRCm39) missense probably damaging 0.97
R3967:Myof UTSW 19 38,011,058 (GRCm39) missense possibly damaging 0.59
R3967:Myof UTSW 19 37,889,711 (GRCm39) missense probably damaging 1.00
R3970:Myof UTSW 19 38,011,058 (GRCm39) missense possibly damaging 0.59
R3970:Myof UTSW 19 37,889,711 (GRCm39) missense probably damaging 1.00
R4238:Myof UTSW 19 37,911,456 (GRCm39) nonsense probably null
R4405:Myof UTSW 19 37,911,426 (GRCm39) missense probably damaging 0.97
R4406:Myof UTSW 19 37,911,426 (GRCm39) missense probably damaging 0.97
R4407:Myof UTSW 19 37,911,426 (GRCm39) missense probably damaging 0.97
R4408:Myof UTSW 19 37,911,426 (GRCm39) missense probably damaging 0.97
R4561:Myof UTSW 19 37,911,438 (GRCm39) missense probably benign
R4606:Myof UTSW 19 37,955,547 (GRCm39) missense probably damaging 1.00
R4778:Myof UTSW 19 37,938,011 (GRCm39) missense probably damaging 1.00
R4801:Myof UTSW 19 37,934,186 (GRCm39) missense probably benign 0.24
R4802:Myof UTSW 19 37,934,186 (GRCm39) missense probably benign 0.24
R4812:Myof UTSW 19 37,905,007 (GRCm39) missense probably damaging 1.00
R4884:Myof UTSW 19 37,930,805 (GRCm39) missense probably damaging 1.00
R4964:Myof UTSW 19 37,924,300 (GRCm39) missense probably damaging 0.97
R4966:Myof UTSW 19 37,924,300 (GRCm39) missense probably damaging 0.97
R5069:Myof UTSW 19 37,893,773 (GRCm39) missense possibly damaging 0.65
R5181:Myof UTSW 19 37,921,071 (GRCm39) missense possibly damaging 0.95
R5376:Myof UTSW 19 37,904,848 (GRCm39) missense probably damaging 1.00
R5384:Myof UTSW 19 37,941,435 (GRCm39) missense probably damaging 0.98
R5543:Myof UTSW 19 37,969,778 (GRCm39) missense probably benign 0.00
R5626:Myof UTSW 19 37,911,438 (GRCm39) missense probably benign
R5865:Myof UTSW 19 37,899,382 (GRCm39) missense probably damaging 1.00
R5919:Myof UTSW 19 38,012,818 (GRCm39) missense possibly damaging 0.95
R5924:Myof UTSW 19 37,971,421 (GRCm39) missense probably damaging 0.97
R5997:Myof UTSW 19 37,893,747 (GRCm39) missense possibly damaging 0.90
R5999:Myof UTSW 19 37,928,304 (GRCm39) nonsense probably null
R6039:Myof UTSW 19 37,966,132 (GRCm39) missense probably damaging 1.00
R6039:Myof UTSW 19 37,966,132 (GRCm39) missense probably damaging 1.00
R6041:Myof UTSW 19 37,913,068 (GRCm39) missense probably damaging 1.00
R6051:Myof UTSW 19 38,012,809 (GRCm39) missense probably damaging 1.00
R6057:Myof UTSW 19 37,915,429 (GRCm39) critical splice donor site probably null
R6089:Myof UTSW 19 37,955,508 (GRCm39) missense probably benign 0.37
R6195:Myof UTSW 19 37,901,805 (GRCm39) missense possibly damaging 0.89
R6478:Myof UTSW 19 37,892,279 (GRCm39) missense probably damaging 1.00
R6545:Myof UTSW 19 37,930,745 (GRCm39) missense possibly damaging 0.67
R6655:Myof UTSW 19 37,923,239 (GRCm39) missense probably damaging 1.00
R6715:Myof UTSW 19 37,956,794 (GRCm39) missense probably benign 0.04
R6737:Myof UTSW 19 37,931,962 (GRCm39) missense probably benign 0.01
R6837:Myof UTSW 19 37,911,404 (GRCm39) critical splice donor site probably null
R7096:Myof UTSW 19 37,924,648 (GRCm39) missense probably damaging 1.00
R7308:Myof UTSW 19 37,899,359 (GRCm39) missense probably damaging 0.98
R7328:Myof UTSW 19 37,904,847 (GRCm39) missense probably damaging 1.00
R7485:Myof UTSW 19 37,939,939 (GRCm39) nonsense probably null
R7554:Myof UTSW 19 37,942,958 (GRCm39) missense probably benign 0.09
R7759:Myof UTSW 19 37,928,346 (GRCm39) missense probably benign 0.00
R7779:Myof UTSW 19 37,927,838 (GRCm39) missense probably damaging 1.00
R8116:Myof UTSW 19 37,921,167 (GRCm39) missense probably damaging 0.99
R8264:Myof UTSW 19 37,909,881 (GRCm39) missense probably damaging 1.00
R8415:Myof UTSW 19 37,983,872 (GRCm39) missense probably benign
R8756:Myof UTSW 19 37,928,400 (GRCm39) missense probably benign
R8777:Myof UTSW 19 37,968,841 (GRCm39) missense probably benign 0.01
R8777-TAIL:Myof UTSW 19 37,968,841 (GRCm39) missense probably benign 0.01
R8835:Myof UTSW 19 37,955,547 (GRCm39) missense possibly damaging 0.92
R9046:Myof UTSW 19 37,923,112 (GRCm39) intron probably benign
R9396:Myof UTSW 19 37,923,294 (GRCm39) missense probably damaging 1.00
R9415:Myof UTSW 19 37,941,412 (GRCm39) missense probably damaging 1.00
R9450:Myof UTSW 19 37,949,374 (GRCm39) missense probably damaging 1.00
R9451:Myof UTSW 19 37,966,096 (GRCm39) critical splice donor site probably null
R9537:Myof UTSW 19 37,896,054 (GRCm39) missense probably damaging 1.00
R9592:Myof UTSW 19 38,031,737 (GRCm39) missense probably damaging 0.99
R9616:Myof UTSW 19 37,923,263 (GRCm39) missense possibly damaging 0.52
X0024:Myof UTSW 19 37,963,045 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TGAGTTCAGTTTCACCAAGGGAG -3'
(R):5'- GAAACGCACTGTCATAGGAGC -3'

Sequencing Primer
(F):5'- TTTCACCAAGGGAGAGCAAATGC -3'
(R):5'- ACTGTCATAGGAGCTCGACTTC -3'
Posted On 2022-11-14