Incidental Mutation 'R9751:Plce1'
ID 732546
Institutional Source Beutler Lab
Gene Symbol Plce1
Ensembl Gene ENSMUSG00000024998
Gene Name phospholipase C, epsilon 1
Synonyms PLCepsilon, 4933403A21Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.488) question?
Stock # R9751 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 38469557-38773474 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 38717414 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Phenylalanine at position 1401 (S1401F)
Ref Sequence ENSEMBL: ENSMUSP00000138330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169713] [ENSMUST00000182267] [ENSMUST00000182481]
AlphaFold Q8K4S1
Predicted Effect probably damaging
Transcript: ENSMUST00000169713
AA Change: S1401F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130604
Gene: ENSMUSG00000024998
AA Change: S1401F

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 7.6e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1561 1575 N/A INTRINSIC
SCOP:d1qasa3 1634 1662 1e-3 SMART
low complexity region 1666 1680 N/A INTRINSIC
PLCYc 1710 1826 4.28e-46 SMART
C2 1850 1948 3.7e-10 SMART
PDB:2BYE|A 1986 2094 6e-47 PDB
RA 2115 2218 1.12e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182267
AA Change: S1401F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138330
Gene: ENSMUSG00000024998
AA Change: S1401F

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 5.9e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1552 1581 N/A INTRINSIC
SCOP:d1qasa3 1648 1676 1e-3 SMART
low complexity region 1680 1694 N/A INTRINSIC
PLCYc 1724 1840 4.28e-46 SMART
C2 1864 1962 3.7e-10 SMART
PDB:2BYE|A 2000 2108 6e-47 PDB
RA 2129 2232 1.12e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182481
AA Change: S1401F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138360
Gene: ENSMUSG00000024998
AA Change: S1401F

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 8e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1561 1575 N/A INTRINSIC
SCOP:d1qasa3 1634 1662 1e-3 SMART
low complexity region 1666 1680 N/A INTRINSIC
PLCYc 1710 1826 4.28e-46 SMART
C2 1850 1948 3.7e-10 SMART
PDB:2BYE|A 1986 2094 6e-47 PDB
RA 2115 2218 1.12e-2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase enzyme that catalyzes the hydrolysis of phosphatidylinositol-4,5-bisphosphate to generate two second messengers: inositol 1,4,5-triphosphate (IP3) and diacylglycerol (DAG). These second messengers subsequently regulate various processes affecting cell growth, differentiation, and gene expression. This enzyme is regulated by small monomeric GTPases of the Ras and Rho families and by heterotrimeric G proteins. In addition to its phospholipase C catalytic activity, this enzyme has an N-terminal domain with guanine nucleotide exchange (GEF) activity. Mutations in this gene cause early-onset nephrotic syndrome; characterized by proteinuria, edema, and diffuse mesangial sclerosis or focal and segmental glomerulosclerosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mutation of this gene results in a congenital semilunar valvulogenesis defect which causes regurgitation and stenosis, and decreased incidence of induced skin tumors. Another mutant exhibits decreased cardiac contraction and increased hypertrophy in response to chronic stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,881,126 (GRCm39) N514D probably benign Het
Adgre1 G A 17: 57,757,101 (GRCm39) R786H probably null Het
Ankrd7 G A 6: 18,868,024 (GRCm39) V97I probably damaging Het
Bltp1 A G 3: 37,065,889 (GRCm39) I54M Het
Bmper C T 9: 23,318,009 (GRCm39) P543S possibly damaging Het
Brwd1 A T 16: 95,795,015 (GRCm39) M2233K possibly damaging Het
C1s2 G T 6: 124,602,553 (GRCm39) P553T probably damaging Het
Cachd1 G A 4: 100,823,438 (GRCm39) V497I possibly damaging Het
Cacng4 A G 11: 107,626,019 (GRCm39) S191P probably damaging Het
Cd109 C A 9: 78,605,442 (GRCm39) T1015K probably damaging Het
Clstn2 A G 9: 97,339,703 (GRCm39) L756P probably damaging Het
Crybg3 A T 16: 59,377,887 (GRCm39) D1122E possibly damaging Het
Csf2 A T 11: 54,140,420 (GRCm39) L6* probably null Het
Csnk1g2 T A 10: 80,473,745 (GRCm39) Y71N possibly damaging Het
Dlg2 C A 7: 90,564,731 (GRCm39) H116N probably benign Het
Dnah14 C T 1: 181,619,610 (GRCm39) S3978L probably damaging Het
Dpp8 C T 9: 64,960,453 (GRCm39) T328I probably null Het
Dync2i1 T A 12: 116,205,403 (GRCm39) probably null Het
Dysf T C 6: 84,163,450 (GRCm39) V1625A probably damaging Het
Efcab3 G A 11: 104,783,911 (GRCm39) G2754E probably benign Het
Egf C A 3: 129,548,538 (GRCm39) V26F probably damaging Het
Eif1ad19 T C 12: 87,740,526 (GRCm39) N11S possibly damaging Het
Fam20a T A 11: 109,565,992 (GRCm39) Y414F probably damaging Het
Fsip2 T C 2: 82,818,241 (GRCm39) I4658T probably benign Het
Hycc1 C T 5: 24,196,748 (GRCm39) E47K probably benign Het
Igflr1 A T 7: 30,266,653 (GRCm39) Q167L possibly damaging Het
Krt79 T G 15: 101,839,196 (GRCm39) E424D probably benign Het
Map3k6 A G 4: 132,979,168 (GRCm39) probably null Het
Mcpt4 A G 14: 56,297,511 (GRCm39) I215T probably damaging Het
Med13 T C 11: 86,189,984 (GRCm39) Y975C probably damaging Het
Meioc T A 11: 102,566,419 (GRCm39) Y678* probably null Het
Myof T C 19: 37,924,818 (GRCm39) T1190A probably benign Het
Nap1l4 A C 7: 143,088,132 (GRCm39) probably benign Het
Ncapg T C 5: 45,851,195 (GRCm39) V796A probably damaging Het
Or4c10b C T 2: 89,711,956 (GRCm39) T262I probably benign Het
Or4c119 C T 2: 88,986,782 (GRCm39) V246M possibly damaging Het
Or5d39 T A 2: 87,979,614 (GRCm39) I250L probably benign Het
Or5d40 T A 2: 88,015,260 (GRCm39) V13E possibly damaging Het
Or5p68 T C 7: 107,945,645 (GRCm39) Y181C probably benign Het
Paxbp1 A G 16: 90,824,188 (GRCm39) S515P probably benign Het
Pip4p1 A G 14: 51,165,436 (GRCm39) V257A probably benign Het
Rptor A G 11: 119,777,964 (GRCm39) K1043E probably benign Het
Rtn4rl2 T G 2: 84,711,039 (GRCm39) N75T probably damaging Het
Slc35f4 A G 14: 49,536,291 (GRCm39) I448T possibly damaging Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,278,612 (GRCm39) probably benign Het
Tas2r115 A G 6: 132,714,918 (GRCm39) I11T possibly damaging Het
Tbc1d5 A G 17: 51,181,680 (GRCm39) V351A possibly damaging Het
Trim43b A T 9: 88,971,570 (GRCm39) D195E probably benign Het
Trim65 C A 11: 116,021,564 (GRCm39) A90S probably benign Het
Trip11 C T 12: 101,850,765 (GRCm39) V1100I possibly damaging Het
Tyrp1 A G 4: 80,759,012 (GRCm39) E295G probably null Het
Ube2g2 G A 10: 77,480,307 (GRCm39) V138I probably benign Het
Other mutations in Plce1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Plce1 APN 19 38,734,232 (GRCm39) missense probably damaging 0.99
IGL00336:Plce1 APN 19 38,640,350 (GRCm39) missense probably damaging 1.00
IGL00430:Plce1 APN 19 38,713,461 (GRCm39) missense probably damaging 1.00
IGL00466:Plce1 APN 19 38,709,473 (GRCm39) missense probably damaging 0.99
IGL00477:Plce1 APN 19 38,513,576 (GRCm39) missense probably benign 0.39
IGL00839:Plce1 APN 19 38,687,006 (GRCm39) missense probably damaging 1.00
IGL01292:Plce1 APN 19 38,640,229 (GRCm39) splice site probably benign
IGL01665:Plce1 APN 19 38,513,331 (GRCm39) missense probably benign 0.01
IGL01826:Plce1 APN 19 38,727,682 (GRCm39) splice site probably benign
IGL01833:Plce1 APN 19 38,709,425 (GRCm39) missense probably damaging 1.00
IGL02201:Plce1 APN 19 38,757,890 (GRCm39) splice site probably benign
IGL02276:Plce1 APN 19 38,513,201 (GRCm39) missense probably benign 0.05
IGL02477:Plce1 APN 19 38,707,997 (GRCm39) splice site probably benign
IGL02746:Plce1 APN 19 38,686,916 (GRCm39) missense probably damaging 1.00
Angel_food UTSW 19 38,715,457 (GRCm39) splice site probably benign
Heavenly UTSW 19 38,766,433 (GRCm39) missense probably damaging 1.00
R0058:Plce1 UTSW 19 38,513,628 (GRCm39) missense possibly damaging 0.90
R0058:Plce1 UTSW 19 38,513,628 (GRCm39) missense possibly damaging 0.90
R0064:Plce1 UTSW 19 38,769,228 (GRCm39) critical splice donor site probably null
R0116:Plce1 UTSW 19 38,710,265 (GRCm39) missense probably benign
R0138:Plce1 UTSW 19 38,512,863 (GRCm39) missense possibly damaging 0.49
R0240:Plce1 UTSW 19 38,717,330 (GRCm39) missense probably damaging 0.99
R0240:Plce1 UTSW 19 38,717,330 (GRCm39) missense probably damaging 0.99
R0504:Plce1 UTSW 19 38,766,465 (GRCm39) splice site probably benign
R0506:Plce1 UTSW 19 38,748,582 (GRCm39) missense probably benign 0.04
R0578:Plce1 UTSW 19 38,766,383 (GRCm39) missense probably damaging 1.00
R0645:Plce1 UTSW 19 38,766,433 (GRCm39) missense probably damaging 1.00
R0730:Plce1 UTSW 19 38,705,135 (GRCm39) missense probably damaging 0.98
R0920:Plce1 UTSW 19 38,724,965 (GRCm39) missense probably damaging 1.00
R1223:Plce1 UTSW 19 38,755,670 (GRCm39) missense probably damaging 1.00
R1223:Plce1 UTSW 19 38,690,457 (GRCm39) missense probably damaging 1.00
R1484:Plce1 UTSW 19 38,693,783 (GRCm39) nonsense probably null
R1488:Plce1 UTSW 19 38,705,247 (GRCm39) missense possibly damaging 0.92
R1598:Plce1 UTSW 19 38,709,440 (GRCm39) missense probably damaging 1.00
R1624:Plce1 UTSW 19 38,713,219 (GRCm39) missense probably damaging 1.00
R1732:Plce1 UTSW 19 38,705,282 (GRCm39) missense possibly damaging 0.56
R1778:Plce1 UTSW 19 38,769,234 (GRCm39) splice site probably benign
R1797:Plce1 UTSW 19 38,747,392 (GRCm39) critical splice donor site probably null
R1872:Plce1 UTSW 19 38,748,521 (GRCm39) missense probably damaging 1.00
R1876:Plce1 UTSW 19 38,769,067 (GRCm39) missense probably damaging 1.00
R1991:Plce1 UTSW 19 38,766,368 (GRCm39) missense probably damaging 1.00
R2080:Plce1 UTSW 19 38,715,457 (GRCm39) splice site probably benign
R2103:Plce1 UTSW 19 38,766,368 (GRCm39) missense probably damaging 1.00
R2376:Plce1 UTSW 19 38,766,430 (GRCm39) missense probably benign 0.02
R2471:Plce1 UTSW 19 38,768,370 (GRCm39) missense probably damaging 1.00
R2511:Plce1 UTSW 19 38,748,498 (GRCm39) missense probably damaging 1.00
R2842:Plce1 UTSW 19 38,512,727 (GRCm39) missense probably damaging 1.00
R3037:Plce1 UTSW 19 38,766,328 (GRCm39) missense probably damaging 0.98
R3104:Plce1 UTSW 19 38,608,963 (GRCm39) missense probably benign 0.00
R3700:Plce1 UTSW 19 38,693,781 (GRCm39) missense probably damaging 1.00
R3750:Plce1 UTSW 19 38,766,343 (GRCm39) missense probably benign
R3753:Plce1 UTSW 19 38,640,278 (GRCm39) missense probably benign 0.09
R4027:Plce1 UTSW 19 38,512,709 (GRCm39) missense probably damaging 1.00
R4057:Plce1 UTSW 19 38,748,563 (GRCm39) missense probably damaging 1.00
R4376:Plce1 UTSW 19 38,693,891 (GRCm39) critical splice donor site probably null
R4433:Plce1 UTSW 19 38,755,745 (GRCm39) missense probably damaging 1.00
R4520:Plce1 UTSW 19 38,512,763 (GRCm39) missense possibly damaging 0.46
R4521:Plce1 UTSW 19 38,512,763 (GRCm39) missense possibly damaging 0.46
R4522:Plce1 UTSW 19 38,512,763 (GRCm39) missense possibly damaging 0.46
R4524:Plce1 UTSW 19 38,512,763 (GRCm39) missense possibly damaging 0.46
R4650:Plce1 UTSW 19 38,513,088 (GRCm39) missense probably benign 0.30
R4673:Plce1 UTSW 19 38,737,840 (GRCm39) missense possibly damaging 0.51
R4701:Plce1 UTSW 19 38,713,451 (GRCm39) missense probably benign 0.33
R4828:Plce1 UTSW 19 38,757,943 (GRCm39) missense probably damaging 1.00
R5103:Plce1 UTSW 19 38,755,659 (GRCm39) missense probably damaging 1.00
R5112:Plce1 UTSW 19 38,640,277 (GRCm39) missense probably benign 0.00
R5236:Plce1 UTSW 19 38,758,791 (GRCm39) missense probably benign 0.11
R5268:Plce1 UTSW 19 38,747,279 (GRCm39) missense possibly damaging 0.71
R5288:Plce1 UTSW 19 38,748,535 (GRCm39) missense probably damaging 1.00
R5384:Plce1 UTSW 19 38,748,535 (GRCm39) missense probably damaging 1.00
R5386:Plce1 UTSW 19 38,748,535 (GRCm39) missense probably damaging 1.00
R5448:Plce1 UTSW 19 38,768,361 (GRCm39) missense probably damaging 1.00
R5452:Plce1 UTSW 19 38,608,926 (GRCm39) missense probably benign 0.01
R6004:Plce1 UTSW 19 38,710,315 (GRCm39) missense probably damaging 1.00
R6062:Plce1 UTSW 19 38,513,195 (GRCm39) missense probably benign
R6147:Plce1 UTSW 19 38,690,481 (GRCm39) missense probably damaging 1.00
R6247:Plce1 UTSW 19 38,734,289 (GRCm39) missense probably damaging 1.00
R6278:Plce1 UTSW 19 38,713,495 (GRCm39) splice site probably null
R6306:Plce1 UTSW 19 38,757,909 (GRCm39) missense probably damaging 1.00
R6317:Plce1 UTSW 19 38,512,974 (GRCm39) nonsense probably null
R6437:Plce1 UTSW 19 38,513,576 (GRCm39) missense probably benign 0.39
R6522:Plce1 UTSW 19 38,736,965 (GRCm39) splice site probably null
R7034:Plce1 UTSW 19 38,727,801 (GRCm39) missense probably damaging 1.00
R7036:Plce1 UTSW 19 38,727,801 (GRCm39) missense probably damaging 1.00
R7037:Plce1 UTSW 19 38,690,461 (GRCm39) missense probably damaging 1.00
R7069:Plce1 UTSW 19 38,747,384 (GRCm39) missense probably damaging 1.00
R7180:Plce1 UTSW 19 38,768,229 (GRCm39) missense probably damaging 1.00
R7189:Plce1 UTSW 19 38,748,581 (GRCm39) missense probably damaging 0.97
R7227:Plce1 UTSW 19 38,715,346 (GRCm39) missense probably benign 0.00
R7253:Plce1 UTSW 19 38,686,952 (GRCm39) missense probably damaging 1.00
R7278:Plce1 UTSW 19 38,768,340 (GRCm39) missense possibly damaging 0.58
R7287:Plce1 UTSW 19 38,690,347 (GRCm39) missense probably benign 0.02
R7422:Plce1 UTSW 19 38,640,329 (GRCm39) missense probably damaging 1.00
R7557:Plce1 UTSW 19 38,753,848 (GRCm39) missense probably benign 0.30
R7607:Plce1 UTSW 19 38,513,196 (GRCm39) missense probably benign
R7615:Plce1 UTSW 19 38,513,109 (GRCm39) missense probably benign 0.18
R7653:Plce1 UTSW 19 38,737,763 (GRCm39) missense probably benign 0.20
R7685:Plce1 UTSW 19 38,736,877 (GRCm39) missense probably benign 0.00
R7716:Plce1 UTSW 19 38,705,295 (GRCm39) missense probably benign
R7744:Plce1 UTSW 19 38,608,899 (GRCm39) missense possibly damaging 0.93
R7790:Plce1 UTSW 19 38,769,140 (GRCm39) missense probably damaging 0.97
R7921:Plce1 UTSW 19 38,608,997 (GRCm39) missense probably benign 0.03
R8070:Plce1 UTSW 19 38,690,283 (GRCm39) missense probably damaging 0.99
R8087:Plce1 UTSW 19 38,724,965 (GRCm39) missense probably damaging 1.00
R8116:Plce1 UTSW 19 38,513,262 (GRCm39) missense probably benign 0.32
R8178:Plce1 UTSW 19 38,761,423 (GRCm39) missense possibly damaging 0.93
R8321:Plce1 UTSW 19 38,640,380 (GRCm39) missense probably benign 0.00
R8416:Plce1 UTSW 19 38,761,441 (GRCm39) missense possibly damaging 0.77
R8544:Plce1 UTSW 19 38,512,903 (GRCm39) missense probably benign 0.00
R8713:Plce1 UTSW 19 38,513,345 (GRCm39) missense probably benign 0.01
R8850:Plce1 UTSW 19 38,512,811 (GRCm39) missense probably benign
R9217:Plce1 UTSW 19 38,748,551 (GRCm39) missense probably damaging 1.00
R9231:Plce1 UTSW 19 38,705,040 (GRCm39) missense probably benign 0.13
R9232:Plce1 UTSW 19 38,705,423 (GRCm39) missense probably benign 0.16
R9332:Plce1 UTSW 19 38,726,377 (GRCm39) missense probably damaging 1.00
R9473:Plce1 UTSW 19 38,766,337 (GRCm39) missense possibly damaging 0.93
R9474:Plce1 UTSW 19 38,766,337 (GRCm39) missense possibly damaging 0.93
R9475:Plce1 UTSW 19 38,766,337 (GRCm39) missense possibly damaging 0.93
R9476:Plce1 UTSW 19 38,766,337 (GRCm39) missense possibly damaging 0.93
R9780:Plce1 UTSW 19 38,609,134 (GRCm39) missense possibly damaging 0.94
R9781:Plce1 UTSW 19 38,513,654 (GRCm39) missense probably damaging 1.00
RF018:Plce1 UTSW 19 38,705,651 (GRCm39) missense probably damaging 0.99
X0022:Plce1 UTSW 19 38,715,443 (GRCm39) missense probably damaging 1.00
X0065:Plce1 UTSW 19 38,766,358 (GRCm39) missense possibly damaging 0.48
Z1176:Plce1 UTSW 19 38,757,904 (GRCm39) missense probably damaging 1.00
Z1176:Plce1 UTSW 19 38,713,424 (GRCm39) nonsense probably null
Z1176:Plce1 UTSW 19 38,690,338 (GRCm39) missense probably damaging 1.00
Z1177:Plce1 UTSW 19 38,640,286 (GRCm39) missense probably null 0.48
Predicted Primers PCR Primer
(F):5'- TGCTCTGACGCAGCCTTAAG -3'
(R):5'- TTTCTTTGCCTACAATGCAGGG -3'

Sequencing Primer
(F):5'- GCAGCCTTAAGAACATGTGTTTCG -3'
(R):5'- TTGCCTACAATGCAGGGTAAGTATAG -3'
Posted On 2022-11-14