Incidental Mutation 'R9752:Flg2'
ID 732557
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Name filaggrin family member 2
Synonyms EG229574
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock # R9752 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 93197278-93221391 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 93201160 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 165 (D165V)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000098884
AA Change: D165V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: D165V

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,570 N371K probably benign Het
Ano2 C T 6: 125,863,536 T390I probably damaging Het
Cc2d2b T C 19: 40,792,827 V772A probably damaging Het
Cd109 A G 9: 78,707,552 I1294V probably benign Het
Cic A G 7: 25,271,978 E378G probably damaging Het
Clhc1 C T 11: 29,557,778 P175L probably benign Het
Clip1 T C 5: 123,621,946 E783G probably damaging Het
Cnot1 A G 8: 95,761,391 Y546H probably damaging Het
Cog7 C A 7: 121,981,416 probably null Het
Cr2 T C 1: 195,141,267 T1008A probably benign Het
Diaph1 T C 18: 37,903,071 T196A unknown Het
Fstl1 T G 16: 37,829,172 N249K probably damaging Het
Gatad2a A G 8: 69,912,189 V515A probably benign Het
Gbp2b A T 3: 142,608,156 D399V probably benign Het
Gna14 G A 19: 16,609,417 V319I probably benign Het
Grip1 A G 10: 120,035,351 D661G possibly damaging Het
Gtf3c4 C A 2: 28,834,114 L535F probably damaging Het
Haus8 A C 8: 71,263,087 S36A probably damaging Het
Hectd4 A T 5: 121,310,681 Y364F probably benign Het
Hectd4 C T 5: 121,334,352 A2717V possibly damaging Het
Hsf5 C T 11: 87,622,883 T258M probably benign Het
Ifi209 A T 1: 173,644,669 I359F probably damaging Het
Ighmbp2 A G 19: 3,274,360 V302A probably benign Het
Iqgap3 C A 3: 88,108,869 F986L probably damaging Het
Itgav T A 2: 83,770,107 probably null Het
Kcp A T 6: 29,497,755 D502E probably damaging Het
Kif15 T C 9: 122,995,825 probably null Het
Lipo2 C G 19: 33,745,821 K189N possibly damaging Het
Lrch4 T A 5: 137,637,956 S390T probably benign Het
Mast2 G T 4: 116,322,311 H389N probably benign Het
Med13 A G 11: 86,283,321 Y1784H possibly damaging Het
Micu3 A G 8: 40,380,710 K462E possibly damaging Het
Mrps10 T C 17: 47,372,647 probably null Het
Msh6 T C 17: 87,986,535 L906P probably damaging Het
Nphp4 A G 4: 152,537,280 E531G probably benign Het
Nrp2 A T 1: 62,812,567 Y825F probably benign Het
Ntn1 C T 11: 68,385,886 V79M possibly damaging Het
Nxnl2 A G 13: 51,171,471 D50G probably damaging Het
Olfr1 T A 11: 73,395,653 Y123F possibly damaging Het
Olfr1395 T C 11: 49,148,854 M199T probably benign Het
Olfr584 T A 7: 103,086,462 C310S probably benign Het
Olfr651 A T 7: 104,553,323 I135F possibly damaging Het
Olfr818 T C 10: 129,945,121 R314G probably benign Het
Olfr872 G A 9: 20,259,908 V23I probably benign Het
Ppp1r42 A G 1: 10,003,449 probably benign Het
Ppp4r3a A T 12: 101,042,504 N692K probably benign Het
Prr11 T C 11: 87,103,590 T77A possibly damaging Het
Rrn3 A G 16: 13,813,231 I644V probably benign Het
Scd4 T C 19: 44,334,036 S23P probably benign Het
Sdccag3 T C 2: 26,386,978 N247D probably benign Het
Slc26a2 T A 18: 61,201,938 S148C probably benign Het
Slc7a8 T C 14: 54,758,474 E157G probably benign Het
Spi1 A G 2: 91,113,321 H70R probably benign Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,301,649 probably benign Het
Tlr4 A G 4: 66,839,675 N235S probably benign Het
Trpc6 C A 9: 8,643,640 S475R probably benign Het
Usp34 C T 11: 23,459,182 P2674L probably benign Het
Usp48 G A 4: 137,613,826 G379D probably damaging Het
Vkorc1l1 T A 5: 129,982,237 C97* probably null Het
Wfikkn2 T C 11: 94,238,385 E310G probably benign Het
Zfp266 T A 9: 20,500,200 N227I probably benign Het
Zfp335 C T 2: 164,907,427 probably null Het
Zfp677 T A 17: 21,398,249 C523S probably damaging Het
Zrsr2 GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT X: 163,936,754 probably benign Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93202109 nonsense probably null
IGL00092:Flg2 APN 3 93219855 missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93203278 missense unknown
IGL01077:Flg2 APN 3 93220206 missense unknown
IGL01093:Flg2 APN 3 93202371 missense unknown
IGL01120:Flg2 APN 3 93201168 missense probably damaging 0.99
IGL01473:Flg2 APN 3 93203020 missense unknown
IGL01584:Flg2 APN 3 93213466 missense unknown
IGL01584:Flg2 APN 3 93215470 missense unknown
IGL01686:Flg2 APN 3 93202284 missense unknown
IGL02207:Flg2 APN 3 93220128 missense unknown
IGL02294:Flg2 APN 3 93203746 missense unknown
IGL02418:Flg2 APN 3 93201054 missense probably benign 0.26
IGL02581:Flg2 APN 3 93219892 missense unknown
IGL02719:Flg2 APN 3 93220131 nonsense probably null
IGL02795:Flg2 APN 3 93203613 missense unknown
IGL02893:Flg2 APN 3 93203613 missense unknown
IGL02958:Flg2 APN 3 93203613 missense unknown
IGL03060:Flg2 APN 3 93203613 missense unknown
IGL03088:Flg2 APN 3 93203191 missense unknown
IGL03165:Flg2 APN 3 93214611 missense unknown
IGL03342:Flg2 APN 3 93201235 missense probably damaging 1.00
IGL03352:Flg2 APN 3 93202494 missense unknown
IGL02796:Flg2 UTSW 3 93203613 missense unknown
IGL02837:Flg2 UTSW 3 93201737 missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93203781 missense unknown
R0087:Flg2 UTSW 3 93202431 missense unknown
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0315:Flg2 UTSW 3 93214722 missense unknown
R0390:Flg2 UTSW 3 93200355 splice site probably benign
R0462:Flg2 UTSW 3 93201437 missense probably benign 0.18
R0553:Flg2 UTSW 3 93203584 missense unknown
R0828:Flg2 UTSW 3 93203332 missense unknown
R1006:Flg2 UTSW 3 93201207 missense probably benign 0.41
R1444:Flg2 UTSW 3 93202313 missense unknown
R1497:Flg2 UTSW 3 93219769 missense unknown
R1518:Flg2 UTSW 3 93203138 missense unknown
R1737:Flg2 UTSW 3 93203621 missense unknown
R1780:Flg2 UTSW 3 93202999 missense unknown
R1797:Flg2 UTSW 3 93200976 missense probably damaging 1.00
R2065:Flg2 UTSW 3 93202231 missense unknown
R2168:Flg2 UTSW 3 93201937 missense probably damaging 1.00
R2220:Flg2 UTSW 3 93202185 missense unknown
R2292:Flg2 UTSW 3 93220677 missense unknown
R2327:Flg2 UTSW 3 93203606 nonsense probably null
R2512:Flg2 UTSW 3 93201775 missense probably damaging 1.00
R3177:Flg2 UTSW 3 93214888 missense unknown
R3277:Flg2 UTSW 3 93214888 missense unknown
R3522:Flg2 UTSW 3 93220027 missense unknown
R3779:Flg2 UTSW 3 93202423 missense unknown
R3926:Flg2 UTSW 3 93203215 missense unknown
R4082:Flg2 UTSW 3 93203521 missense unknown
R4407:Flg2 UTSW 3 93214869 missense unknown
R5152:Flg2 UTSW 3 93214977 missense unknown
R5253:Flg2 UTSW 3 93200812 missense probably damaging 1.00
R5290:Flg2 UTSW 3 93220566 missense unknown
R5464:Flg2 UTSW 3 93201970 missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93220446 missense unknown
R5622:Flg2 UTSW 3 93202564 missense unknown
R5788:Flg2 UTSW 3 93200989 missense probably benign 0.41
R5792:Flg2 UTSW 3 93203497 missense unknown
R5831:Flg2 UTSW 3 93200234 missense probably damaging 1.00
R5877:Flg2 UTSW 3 93203449 missense unknown
R6041:Flg2 UTSW 3 93220361 missense probably benign 0.01
R6189:Flg2 UTSW 3 93220074 missense unknown
R6214:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93201272 missense probably benign 0.36
R6288:Flg2 UTSW 3 93203785 missense unknown
R6413:Flg2 UTSW 3 93220376 missense unknown
R6457:Flg2 UTSW 3 93220482 missense unknown
R6468:Flg2 UTSW 3 93214421 missense unknown
R6667:Flg2 UTSW 3 93201761 missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93201335 nonsense probably null
R6996:Flg2 UTSW 3 93202670 missense unknown
R6996:Flg2 UTSW 3 93202949 missense unknown
R7100:Flg2 UTSW 3 93203711 missense unknown
R7133:Flg2 UTSW 3 93219762 missense unknown
R7180:Flg2 UTSW 3 93202833 missense unknown
R7325:Flg2 UTSW 3 93203372 missense unknown
R7349:Flg2 UTSW 3 93220206 missense unknown
R7531:Flg2 UTSW 3 93200870 missense probably damaging 0.99
R7571:Flg2 UTSW 3 93219996 nonsense probably null
R7684:Flg2 UTSW 3 93219649 missense unknown
R7810:Flg2 UTSW 3 93200241 missense possibly damaging 0.70
R7853:Flg2 UTSW 3 93220747 missense unknown
R8031:Flg2 UTSW 3 93220214 missense unknown
R8078:Flg2 UTSW 3 93200275 missense probably damaging 1.00
R8142:Flg2 UTSW 3 93215475 nonsense probably null
R8156:Flg2 UTSW 3 93220083 missense unknown
R8172:Flg2 UTSW 3 93201161 missense possibly damaging 0.94
R8204:Flg2 UTSW 3 93202767 missense unknown
R8262:Flg2 UTSW 3 93220210 missense unknown
R8269:Flg2 UTSW 3 93201880 missense possibly damaging 0.68
R8290:Flg2 UTSW 3 93202762 missense unknown
R8444:Flg2 UTSW 3 93200278 missense probably damaging 0.97
R8670:Flg2 UTSW 3 93201484 missense probably damaging 0.97
R8755:Flg2 UTSW 3 93200813 missense probably damaging 1.00
R9039:Flg2 UTSW 3 93203592 missense unknown
R9116:Flg2 UTSW 3 93202284 missense unknown
R9214:Flg2 UTSW 3 93203577 missense unknown
R9231:Flg2 UTSW 3 93202201 missense unknown
R9553:Flg2 UTSW 3 93214594 missense unknown
R9607:Flg2 UTSW 3 93201412 missense probably damaging 0.98
R9735:Flg2 UTSW 3 93220362 missense unknown
Z1177:Flg2 UTSW 3 93202420 missense unknown
Z1177:Flg2 UTSW 3 93202738 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCTTCAGGGTCAAAGAAGC -3'
(R):5'- CCCTGGTGGTTTAACCTATATCCAG -3'

Sequencing Primer
(F):5'- GTGGCCATCAACACCAAGAGG -3'
(R):5'- ATATCCAGACTCATACTCTTCCTCAG -3'
Posted On 2022-11-14