Incidental Mutation 'R9752:Ntn1'
ID 732590
Institutional Source Beutler Lab
Gene Symbol Ntn1
Ensembl Gene ENSMUSG00000020902
Gene Name netrin 1
Synonyms Netrin-1
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.735) question?
Stock # R9752 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 68100190-68277652 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 68276712 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 79 (V79M)
Ref Sequence ENSEMBL: ENSMUSP00000121193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021284] [ENSMUST00000108674] [ENSMUST00000135141]
AlphaFold O09118
Predicted Effect possibly damaging
Transcript: ENSMUST00000021284
AA Change: V79M

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021284
Gene: ENSMUSG00000020902
AA Change: V79M

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108674
AA Change: V79M

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104314
Gene: ENSMUSG00000020902
AA Change: V79M

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000135141
AA Change: V79M

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121193
Gene: ENSMUSG00000020902
AA Change: V79M

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 159 6.8e-15 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Netrin is included in a family of laminin-related secreted proteins. The function of this gene has not yet been defined; however, netrin is thought to be involved in axon guidance and cell migration during development. Mutations and loss of expression of netrin suggest that variation in netrin may be involved in cancer development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit impaired axonal migration, abnormal semicircular canals, lack of corpus callosum, aberrant commissures, hypoplasia of the optic nerve, motor and balance defects, failure to suckle, and neonatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano2 C T 6: 125,840,499 (GRCm39) T390I probably damaging Het
Cc2d2b T C 19: 40,781,271 (GRCm39) V772A probably damaging Het
Cd109 A G 9: 78,614,834 (GRCm39) I1294V probably benign Het
Cic A G 7: 24,971,403 (GRCm39) E378G probably damaging Het
Clhc1 C T 11: 29,507,778 (GRCm39) P175L probably benign Het
Clip1 T C 5: 123,760,009 (GRCm39) E783G probably damaging Het
Cnot1 A G 8: 96,488,019 (GRCm39) Y546H probably damaging Het
Cog7 C A 7: 121,580,639 (GRCm39) probably null Het
Cr2 T C 1: 194,823,575 (GRCm39) T1008A probably benign Het
Diaph1 T C 18: 38,036,124 (GRCm39) T196A unknown Het
Entr1 T C 2: 26,276,990 (GRCm39) N247D probably benign Het
Flg2 A T 3: 93,108,467 (GRCm39) D165V probably damaging Het
Fstl1 T G 16: 37,649,534 (GRCm39) N249K probably damaging Het
Gatad2a A G 8: 70,364,839 (GRCm39) V515A probably benign Het
Gbp2b A T 3: 142,313,917 (GRCm39) D399V probably benign Het
Gna14 G A 19: 16,586,781 (GRCm39) V319I probably benign Het
Grip1 A G 10: 119,871,256 (GRCm39) D661G possibly damaging Het
Gtf3c4 C A 2: 28,724,126 (GRCm39) L535F probably damaging Het
Haus8 A C 8: 71,715,731 (GRCm39) S36A probably damaging Het
Hectd4 A T 5: 121,448,744 (GRCm39) Y364F probably benign Het
Hectd4 C T 5: 121,472,415 (GRCm39) A2717V possibly damaging Het
Hsf5 C T 11: 87,513,709 (GRCm39) T258M probably benign Het
Ifi209 A T 1: 173,472,235 (GRCm39) I359F probably damaging Het
Ighmbp2 A G 19: 3,324,360 (GRCm39) V302A probably benign Het
Iqgap3 C A 3: 88,016,176 (GRCm39) F986L probably damaging Het
Itgav T A 2: 83,600,451 (GRCm39) probably null Het
Kcp A T 6: 29,497,754 (GRCm39) D502E probably damaging Het
Kif15 T C 9: 122,824,890 (GRCm39) probably null Het
Lipo2 C G 19: 33,723,221 (GRCm39) K189N possibly damaging Het
Lrch4 T A 5: 137,636,218 (GRCm39) S390T probably benign Het
Mast2 G T 4: 116,179,508 (GRCm39) H389N probably benign Het
Med13 A G 11: 86,174,147 (GRCm39) Y1784H possibly damaging Het
Micu3 A G 8: 40,833,751 (GRCm39) K462E possibly damaging Het
Mrps10 T C 17: 47,683,572 (GRCm39) probably null Het
Msh6 T C 17: 88,293,963 (GRCm39) L906P probably damaging Het
Nphp4 A G 4: 152,621,737 (GRCm39) E531G probably benign Het
Nrp2 A T 1: 62,851,726 (GRCm39) Y825F probably benign Het
Nxnl2 A G 13: 51,325,507 (GRCm39) D50G probably damaging Het
Or1e16 T A 11: 73,286,479 (GRCm39) Y123F possibly damaging Het
Or2t26 T C 11: 49,039,681 (GRCm39) M199T probably benign Het
Or52h9 A T 7: 104,202,530 (GRCm39) I135F possibly damaging Het
Or52r1c T A 7: 102,735,669 (GRCm39) C310S probably benign Het
Or6c219 T C 10: 129,780,990 (GRCm39) R314G probably benign Het
Or7e176 G A 9: 20,171,204 (GRCm39) V23I probably benign Het
Ppp1r42 A G 1: 10,073,674 (GRCm39) probably benign Het
Ppp4r3a A T 12: 101,008,763 (GRCm39) N692K probably benign Het
Prr11 T C 11: 86,994,416 (GRCm39) T77A possibly damaging Het
Resf1 T A 6: 149,228,068 (GRCm39) N371K probably benign Het
Rrn3 A G 16: 13,631,095 (GRCm39) I644V probably benign Het
Scd4 T C 19: 44,322,475 (GRCm39) S23P probably benign Het
Slc26a2 T A 18: 61,335,010 (GRCm39) S148C probably benign Het
Slc7a8 T C 14: 54,995,931 (GRCm39) E157G probably benign Het
Spi1 A G 2: 90,943,666 (GRCm39) H70R probably benign Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,278,612 (GRCm39) probably benign Het
Tlr4 A G 4: 66,757,912 (GRCm39) N235S probably benign Het
Trpc6 C A 9: 8,643,641 (GRCm39) S475R probably benign Het
Usp34 C T 11: 23,409,182 (GRCm39) P2674L probably benign Het
Usp48 G A 4: 137,341,137 (GRCm39) G379D probably damaging Het
Vkorc1l1 T A 5: 130,011,078 (GRCm39) C97* probably null Het
Wfikkn2 T C 11: 94,129,211 (GRCm39) E310G probably benign Het
Zfp266 T A 9: 20,411,496 (GRCm39) N227I probably benign Het
Zfp335 C T 2: 164,749,347 (GRCm39) probably null Het
Zfp677 T A 17: 21,618,511 (GRCm39) C523S probably damaging Het
Zrsr2 GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT X: 162,719,750 (GRCm39) probably benign Het
Other mutations in Ntn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ntn1 APN 11 68,117,445 (GRCm39) splice site probably benign
IGL00972:Ntn1 APN 11 68,104,098 (GRCm39) missense possibly damaging 0.83
IGL01695:Ntn1 APN 11 68,117,430 (GRCm39) missense probably benign 0.00
IGL01731:Ntn1 APN 11 68,276,244 (GRCm39) missense probably damaging 1.00
IGL02008:Ntn1 APN 11 68,104,089 (GRCm39) missense probably damaging 1.00
IGL02584:Ntn1 APN 11 68,168,356 (GRCm39) missense probably damaging 1.00
IGL02664:Ntn1 APN 11 68,276,295 (GRCm39) missense probably benign 0.06
R0363:Ntn1 UTSW 11 68,276,369 (GRCm39) missense probably benign 0.44
R1201:Ntn1 UTSW 11 68,104,052 (GRCm39) missense probably damaging 0.96
R1268:Ntn1 UTSW 11 68,103,959 (GRCm39) small deletion probably benign
R1913:Ntn1 UTSW 11 68,104,011 (GRCm39) missense probably damaging 1.00
R2245:Ntn1 UTSW 11 68,276,120 (GRCm39) missense probably benign 0.12
R2248:Ntn1 UTSW 11 68,168,398 (GRCm39) missense possibly damaging 0.95
R2359:Ntn1 UTSW 11 68,276,438 (GRCm39) missense probably damaging 1.00
R2862:Ntn1 UTSW 11 68,276,690 (GRCm39) missense probably benign 0.00
R3830:Ntn1 UTSW 11 68,276,619 (GRCm39) missense probably damaging 1.00
R3851:Ntn1 UTSW 11 68,276,619 (GRCm39) missense probably damaging 1.00
R3852:Ntn1 UTSW 11 68,276,619 (GRCm39) missense probably damaging 1.00
R4413:Ntn1 UTSW 11 68,276,736 (GRCm39) missense probably damaging 1.00
R4870:Ntn1 UTSW 11 68,103,852 (GRCm39) small deletion probably benign
R4871:Ntn1 UTSW 11 68,103,852 (GRCm39) small deletion probably benign
R4952:Ntn1 UTSW 11 68,103,852 (GRCm39) small deletion probably benign
R5001:Ntn1 UTSW 11 68,151,358 (GRCm39) missense probably damaging 1.00
R5279:Ntn1 UTSW 11 68,276,538 (GRCm39) missense probably benign 0.37
R6217:Ntn1 UTSW 11 68,104,158 (GRCm39) missense possibly damaging 0.91
R6505:Ntn1 UTSW 11 68,104,025 (GRCm39) missense probably damaging 1.00
R6669:Ntn1 UTSW 11 68,276,576 (GRCm39) missense probably benign 0.00
R7172:Ntn1 UTSW 11 68,276,493 (GRCm39) missense probably damaging 1.00
R7411:Ntn1 UTSW 11 68,276,915 (GRCm39) missense probably benign 0.15
R8314:Ntn1 UTSW 11 68,276,450 (GRCm39) missense probably damaging 1.00
R9216:Ntn1 UTSW 11 68,117,397 (GRCm39) missense possibly damaging 0.76
R9385:Ntn1 UTSW 11 68,276,013 (GRCm39) missense probably damaging 1.00
R9442:Ntn1 UTSW 11 68,148,485 (GRCm39) intron probably benign
R9697:Ntn1 UTSW 11 68,168,356 (GRCm39) missense probably damaging 1.00
X0027:Ntn1 UTSW 11 68,276,462 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAACTTCTTGCCGAGCGAC -3'
(R):5'- TTCAGGTTTGGAAGCCCCTG -3'

Sequencing Primer
(F):5'- TTCTTGCCGAGCGACAGAGTG -3'
(R):5'- TGGCCACAGCATGATGC -3'
Posted On 2022-11-14