Incidental Mutation 'R9752:Ntn1'
ID 732590
Institutional Source Beutler Lab
Gene Symbol Ntn1
Ensembl Gene ENSMUSG00000020902
Gene Name netrin 1
Synonyms Netrin-1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.732) question?
Stock # R9752 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 68209364-68400823 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 68385886 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 79 (V79M)
Ref Sequence ENSEMBL: ENSMUSP00000121193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021284] [ENSMUST00000108674] [ENSMUST00000135141]
AlphaFold O09118
Predicted Effect possibly damaging
Transcript: ENSMUST00000021284
AA Change: V79M

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021284
Gene: ENSMUSG00000020902
AA Change: V79M

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108674
AA Change: V79M

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104314
Gene: ENSMUSG00000020902
AA Change: V79M

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000135141
AA Change: V79M

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121193
Gene: ENSMUSG00000020902
AA Change: V79M

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 159 6.8e-15 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Netrin is included in a family of laminin-related secreted proteins. The function of this gene has not yet been defined; however, netrin is thought to be involved in axon guidance and cell migration during development. Mutations and loss of expression of netrin suggest that variation in netrin may be involved in cancer development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit impaired axonal migration, abnormal semicircular canals, lack of corpus callosum, aberrant commissures, hypoplasia of the optic nerve, motor and balance defects, failure to suckle, and neonatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,570 N371K probably benign Het
Ano2 C T 6: 125,863,536 T390I probably damaging Het
Cc2d2b T C 19: 40,792,827 V772A probably damaging Het
Cd109 A G 9: 78,707,552 I1294V probably benign Het
Cic A G 7: 25,271,978 E378G probably damaging Het
Clhc1 C T 11: 29,557,778 P175L probably benign Het
Clip1 T C 5: 123,621,946 E783G probably damaging Het
Cnot1 A G 8: 95,761,391 Y546H probably damaging Het
Cog7 C A 7: 121,981,416 probably null Het
Cr2 T C 1: 195,141,267 T1008A probably benign Het
Diaph1 T C 18: 37,903,071 T196A unknown Het
Flg2 A T 3: 93,201,160 D165V probably damaging Het
Fstl1 T G 16: 37,829,172 N249K probably damaging Het
Gatad2a A G 8: 69,912,189 V515A probably benign Het
Gbp2b A T 3: 142,608,156 D399V probably benign Het
Gna14 G A 19: 16,609,417 V319I probably benign Het
Grip1 A G 10: 120,035,351 D661G possibly damaging Het
Gtf3c4 C A 2: 28,834,114 L535F probably damaging Het
Haus8 A C 8: 71,263,087 S36A probably damaging Het
Hectd4 A T 5: 121,310,681 Y364F probably benign Het
Hectd4 C T 5: 121,334,352 A2717V possibly damaging Het
Hsf5 C T 11: 87,622,883 T258M probably benign Het
Ifi209 A T 1: 173,644,669 I359F probably damaging Het
Ighmbp2 A G 19: 3,274,360 V302A probably benign Het
Iqgap3 C A 3: 88,108,869 F986L probably damaging Het
Itgav T A 2: 83,770,107 probably null Het
Kcp A T 6: 29,497,755 D502E probably damaging Het
Kif15 T C 9: 122,995,825 probably null Het
Lipo2 C G 19: 33,745,821 K189N possibly damaging Het
Lrch4 T A 5: 137,637,956 S390T probably benign Het
Mast2 G T 4: 116,322,311 H389N probably benign Het
Med13 A G 11: 86,283,321 Y1784H possibly damaging Het
Micu3 A G 8: 40,380,710 K462E possibly damaging Het
Mrps10 T C 17: 47,372,647 probably null Het
Msh6 T C 17: 87,986,535 L906P probably damaging Het
Nphp4 A G 4: 152,537,280 E531G probably benign Het
Nrp2 A T 1: 62,812,567 Y825F probably benign Het
Nxnl2 A G 13: 51,171,471 D50G probably damaging Het
Olfr1 T A 11: 73,395,653 Y123F possibly damaging Het
Olfr1395 T C 11: 49,148,854 M199T probably benign Het
Olfr584 T A 7: 103,086,462 C310S probably benign Het
Olfr651 A T 7: 104,553,323 I135F possibly damaging Het
Olfr818 T C 10: 129,945,121 R314G probably benign Het
Olfr872 G A 9: 20,259,908 V23I probably benign Het
Ppp1r42 A G 1: 10,003,449 probably benign Het
Ppp4r3a A T 12: 101,042,504 N692K probably benign Het
Prr11 T C 11: 87,103,590 T77A possibly damaging Het
Rrn3 A G 16: 13,813,231 I644V probably benign Het
Scd4 T C 19: 44,334,036 S23P probably benign Het
Sdccag3 T C 2: 26,386,978 N247D probably benign Het
Slc26a2 T A 18: 61,201,938 S148C probably benign Het
Slc7a8 T C 14: 54,758,474 E157G probably benign Het
Spi1 A G 2: 91,113,321 H70R probably benign Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,301,649 probably benign Het
Tlr4 A G 4: 66,839,675 N235S probably benign Het
Trpc6 C A 9: 8,643,640 S475R probably benign Het
Usp34 C T 11: 23,459,182 P2674L probably benign Het
Usp48 G A 4: 137,613,826 G379D probably damaging Het
Vkorc1l1 T A 5: 129,982,237 C97* probably null Het
Wfikkn2 T C 11: 94,238,385 E310G probably benign Het
Zfp266 T A 9: 20,500,200 N227I probably benign Het
Zfp335 C T 2: 164,907,427 probably null Het
Zfp677 T A 17: 21,398,249 C523S probably damaging Het
Zrsr2 GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT X: 163,936,754 probably benign Het
Other mutations in Ntn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ntn1 APN 11 68226619 splice site probably benign
IGL00972:Ntn1 APN 11 68213272 missense possibly damaging 0.83
IGL01695:Ntn1 APN 11 68226604 missense probably benign 0.00
IGL01731:Ntn1 APN 11 68385418 missense probably damaging 1.00
IGL02008:Ntn1 APN 11 68213263 missense probably damaging 1.00
IGL02584:Ntn1 APN 11 68277530 missense probably damaging 1.00
IGL02664:Ntn1 APN 11 68385469 missense probably benign 0.06
R0363:Ntn1 UTSW 11 68385543 missense probably benign 0.44
R1201:Ntn1 UTSW 11 68213226 missense probably damaging 0.96
R1268:Ntn1 UTSW 11 68213133 small deletion probably benign
R1913:Ntn1 UTSW 11 68213185 missense probably damaging 1.00
R2245:Ntn1 UTSW 11 68385294 missense probably benign 0.12
R2248:Ntn1 UTSW 11 68277572 missense possibly damaging 0.95
R2359:Ntn1 UTSW 11 68385612 missense probably damaging 1.00
R2862:Ntn1 UTSW 11 68385864 missense probably benign 0.00
R3830:Ntn1 UTSW 11 68385793 missense probably damaging 1.00
R3851:Ntn1 UTSW 11 68385793 missense probably damaging 1.00
R3852:Ntn1 UTSW 11 68385793 missense probably damaging 1.00
R4413:Ntn1 UTSW 11 68385910 missense probably damaging 1.00
R4870:Ntn1 UTSW 11 68213026 small deletion probably benign
R4871:Ntn1 UTSW 11 68213026 small deletion probably benign
R4952:Ntn1 UTSW 11 68213026 small deletion probably benign
R5001:Ntn1 UTSW 11 68260532 missense probably damaging 1.00
R5279:Ntn1 UTSW 11 68385712 missense probably benign 0.37
R6217:Ntn1 UTSW 11 68213332 missense possibly damaging 0.91
R6505:Ntn1 UTSW 11 68213199 missense probably damaging 1.00
R6669:Ntn1 UTSW 11 68385750 missense probably benign 0.00
R7172:Ntn1 UTSW 11 68385667 missense probably damaging 1.00
R7411:Ntn1 UTSW 11 68386089 missense probably benign 0.15
R8314:Ntn1 UTSW 11 68385624 missense probably damaging 1.00
R9216:Ntn1 UTSW 11 68226571 missense possibly damaging 0.76
R9385:Ntn1 UTSW 11 68385187 missense probably damaging 1.00
R9442:Ntn1 UTSW 11 68257659 intron probably benign
R9697:Ntn1 UTSW 11 68277530 missense probably damaging 1.00
X0027:Ntn1 UTSW 11 68385636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAACTTCTTGCCGAGCGAC -3'
(R):5'- TTCAGGTTTGGAAGCCCCTG -3'

Sequencing Primer
(F):5'- TTCTTGCCGAGCGACAGAGTG -3'
(R):5'- TGGCCACAGCATGATGC -3'
Posted On 2022-11-14