Incidental Mutation 'R9752:Scd4'
ID 732610
Institutional Source Beutler Lab
Gene Symbol Scd4
Ensembl Gene ENSMUSG00000050195
Gene Name stearoyl-coenzyme A desaturase 4
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock # R9752 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 44333092-44346743 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 44334036 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 23 (S23P)
Ref Sequence ENSEMBL: ENSMUSP00000059860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058856]
AlphaFold Q6T707
Predicted Effect probably benign
Transcript: ENSMUST00000058856
AA Change: S23P

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000059860
Gene: ENSMUSG00000050195
AA Change: S23P

DomainStartEndE-ValueType
transmembrane domain 65 87 N/A INTRINSIC
Pfam:FA_desaturase 91 311 7e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,570 N371K probably benign Het
Ano2 C T 6: 125,863,536 T390I probably damaging Het
Cc2d2b T C 19: 40,792,827 V772A probably damaging Het
Cd109 A G 9: 78,707,552 I1294V probably benign Het
Cic A G 7: 25,271,978 E378G probably damaging Het
Clhc1 C T 11: 29,557,778 P175L probably benign Het
Clip1 T C 5: 123,621,946 E783G probably damaging Het
Cnot1 A G 8: 95,761,391 Y546H probably damaging Het
Cog7 C A 7: 121,981,416 probably null Het
Cr2 T C 1: 195,141,267 T1008A probably benign Het
Diaph1 T C 18: 37,903,071 T196A unknown Het
Flg2 A T 3: 93,201,160 D165V probably damaging Het
Fstl1 T G 16: 37,829,172 N249K probably damaging Het
Gatad2a A G 8: 69,912,189 V515A probably benign Het
Gbp2b A T 3: 142,608,156 D399V probably benign Het
Gna14 G A 19: 16,609,417 V319I probably benign Het
Grip1 A G 10: 120,035,351 D661G possibly damaging Het
Gtf3c4 C A 2: 28,834,114 L535F probably damaging Het
Haus8 A C 8: 71,263,087 S36A probably damaging Het
Hectd4 A T 5: 121,310,681 Y364F probably benign Het
Hectd4 C T 5: 121,334,352 A2717V possibly damaging Het
Hsf5 C T 11: 87,622,883 T258M probably benign Het
Ifi209 A T 1: 173,644,669 I359F probably damaging Het
Ighmbp2 A G 19: 3,274,360 V302A probably benign Het
Iqgap3 C A 3: 88,108,869 F986L probably damaging Het
Itgav T A 2: 83,770,107 probably null Het
Kcp A T 6: 29,497,755 D502E probably damaging Het
Kif15 T C 9: 122,995,825 probably null Het
Lipo2 C G 19: 33,745,821 K189N possibly damaging Het
Lrch4 T A 5: 137,637,956 S390T probably benign Het
Mast2 G T 4: 116,322,311 H389N probably benign Het
Med13 A G 11: 86,283,321 Y1784H possibly damaging Het
Micu3 A G 8: 40,380,710 K462E possibly damaging Het
Mrps10 T C 17: 47,372,647 probably null Het
Msh6 T C 17: 87,986,535 L906P probably damaging Het
Nphp4 A G 4: 152,537,280 E531G probably benign Het
Nrp2 A T 1: 62,812,567 Y825F probably benign Het
Ntn1 C T 11: 68,385,886 V79M possibly damaging Het
Nxnl2 A G 13: 51,171,471 D50G probably damaging Het
Olfr1 T A 11: 73,395,653 Y123F possibly damaging Het
Olfr1395 T C 11: 49,148,854 M199T probably benign Het
Olfr584 T A 7: 103,086,462 C310S probably benign Het
Olfr651 A T 7: 104,553,323 I135F possibly damaging Het
Olfr818 T C 10: 129,945,121 R314G probably benign Het
Olfr872 G A 9: 20,259,908 V23I probably benign Het
Ppp1r42 A G 1: 10,003,449 probably benign Het
Ppp4r3a A T 12: 101,042,504 N692K probably benign Het
Prr11 T C 11: 87,103,590 T77A possibly damaging Het
Rrn3 A G 16: 13,813,231 I644V probably benign Het
Sdccag3 T C 2: 26,386,978 N247D probably benign Het
Slc26a2 T A 18: 61,201,938 S148C probably benign Het
Slc7a8 T C 14: 54,758,474 E157G probably benign Het
Spi1 A G 2: 91,113,321 H70R probably benign Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,301,649 probably benign Het
Tlr4 A G 4: 66,839,675 N235S probably benign Het
Trpc6 C A 9: 8,643,640 S475R probably benign Het
Usp34 C T 11: 23,459,182 P2674L probably benign Het
Usp48 G A 4: 137,613,826 G379D probably damaging Het
Vkorc1l1 T A 5: 129,982,237 C97* probably null Het
Wfikkn2 T C 11: 94,238,385 E310G probably benign Het
Zfp266 T A 9: 20,500,200 N227I probably benign Het
Zfp335 C T 2: 164,907,427 probably null Het
Zfp677 T A 17: 21,398,249 C523S probably damaging Het
Zrsr2 GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT X: 163,936,754 probably benign Het
Other mutations in Scd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Scd4 APN 19 44344747 missense possibly damaging 0.54
IGL02824:Scd4 APN 19 44341259 missense probably damaging 1.00
crisco UTSW 19 44339071 missense probably benign 0.24
IGL03098:Scd4 UTSW 19 44333492 start codon destroyed possibly damaging 0.92
R0576:Scd4 UTSW 19 44341246 missense probably benign 0.00
R0655:Scd4 UTSW 19 44338968 missense possibly damaging 0.52
R1792:Scd4 UTSW 19 44337574 nonsense probably null
R1925:Scd4 UTSW 19 44341384 missense probably damaging 0.99
R1995:Scd4 UTSW 19 44334178 missense possibly damaging 0.93
R5018:Scd4 UTSW 19 44337609 missense probably benign 0.09
R5815:Scd4 UTSW 19 44337564 missense probably damaging 1.00
R6036:Scd4 UTSW 19 44344792 missense probably damaging 0.98
R6036:Scd4 UTSW 19 44344792 missense probably damaging 0.98
R6264:Scd4 UTSW 19 44338959 nonsense probably null
R6946:Scd4 UTSW 19 44333514 missense probably null 0.82
R7661:Scd4 UTSW 19 44339071 missense probably benign 0.24
R7957:Scd4 UTSW 19 44341248 missense probably benign 0.00
R8112:Scd4 UTSW 19 44337506 missense probably benign 0.00
R8226:Scd4 UTSW 19 44334133 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAACACATTCTAGGTAGTTTCTGGG -3'
(R):5'- AACCAGTGTGATCCCGTACAG -3'

Sequencing Primer
(F):5'- GGGAAGTTTTCTCTGCTTCATCTAGC -3'
(R):5'- TACAGGGCTCCCACGTG -3'
Posted On 2022-11-14