Incidental Mutation 'R9753:Erbb4'
ID 732612
Institutional Source Beutler Lab
Gene Symbol Erbb4
Ensembl Gene ENSMUSG00000062209
Gene Name erb-b2 receptor tyrosine kinase 4
Synonyms Her4, ErbB4
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9753 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 68071345-69147218 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 68238062 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 809 (H809L)
Ref Sequence ENSEMBL: ENSMUSP00000114123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473]
AlphaFold Q61527
Predicted Effect probably benign
Transcript: ENSMUST00000119142
AA Change: H809L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209
AA Change: H809L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 5e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 1e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121473
AA Change: H809L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209
AA Change: H809L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.6e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.5e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 G A 10: 41,259,496 (GRCm39) V843I Het
Bbs12 T C 3: 37,373,680 (GRCm39) C43R possibly damaging Het
Brwd1 T C 16: 95,825,028 (GRCm39) E1145G probably damaging Het
C2cd4c A C 10: 79,448,067 (GRCm39) I360S probably damaging Het
Carmil2 A G 8: 106,417,539 (GRCm39) N599S probably damaging Het
Cd79b A G 11: 106,203,457 (GRCm39) probably null Het
Ces2c A G 8: 105,580,249 (GRCm39) M489V probably benign Het
Clip4 A G 17: 72,106,068 (GRCm39) N84D probably benign Het
Cramp1 T C 17: 25,191,320 (GRCm39) D1047G possibly damaging Het
Cyp2c69 C T 19: 39,865,991 (GRCm39) V201M probably benign Het
Dock2 A G 11: 34,223,673 (GRCm39) S1154P possibly damaging Het
Elk4 T G 1: 131,945,881 (GRCm39) V253G probably benign Het
Ext1 A T 15: 53,208,067 (GRCm39) D231E probably damaging Het
Fam221b T C 4: 43,665,574 (GRCm39) K295E probably benign Het
Fbrsl1 A G 5: 110,526,835 (GRCm39) F2L unknown Het
Fnip2 C T 3: 79,415,411 (GRCm39) R209H probably benign Het
Gart C T 16: 91,430,949 (GRCm39) G371D probably damaging Het
Gata6 T A 18: 11,064,706 (GRCm39) V506D possibly damaging Het
Gba2 T C 4: 43,568,716 (GRCm39) Y620C probably damaging Het
Gprc6a T C 10: 51,504,364 (GRCm39) N160S probably benign Het
Gstm3 A G 3: 107,875,493 (GRCm39) W46R probably damaging Het
Hcn4 G A 9: 58,751,319 (GRCm39) R315H unknown Het
Hydin T C 8: 111,217,398 (GRCm39) F1429L possibly damaging Het
Iqgap3 C A 3: 88,016,176 (GRCm39) F986L probably damaging Het
Itgb1bp1 A G 12: 21,326,890 (GRCm39) S28P unknown Het
Krt10 A G 11: 99,279,792 (GRCm39) F123L unknown Het
Krt79 T G 15: 101,839,196 (GRCm39) E424D probably benign Het
Lingo4 C T 3: 94,309,493 (GRCm39) R144* probably null Het
Ltbr G A 6: 125,284,348 (GRCm39) R365W probably damaging Het
Nrsn1 C A 13: 25,437,563 (GRCm39) V122L probably benign Het
Or10h5 C A 17: 33,434,688 (GRCm39) G210V possibly damaging Het
Or2r2 T C 6: 42,463,507 (GRCm39) M207V probably benign Het
Or4d6 T A 19: 12,086,056 (GRCm39) M59L probably benign Het
Pcgf6 T C 19: 47,023,073 (GRCm39) T353A probably damaging Het
Pcsk2 T C 2: 143,635,150 (GRCm39) Y342H probably damaging Het
Pou2af1 A T 9: 51,149,636 (GRCm39) N243Y possibly damaging Het
Prkcz T C 4: 155,377,659 (GRCm39) D197G probably benign Het
Sec14l4 G A 11: 3,989,982 (GRCm39) E94K probably benign Het
Sik2 T C 9: 50,807,139 (GRCm39) E757G probably damaging Het
Sipa1l1 T A 12: 82,463,763 (GRCm39) S1154T possibly damaging Het
Speer1k A T 5: 10,999,020 (GRCm39) T53S Het
Ssb T C 2: 69,697,865 (GRCm39) Y175H probably damaging Het
St6galnac6 T C 2: 32,502,261 (GRCm39) I50T probably benign Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,278,612 (GRCm39) probably benign Het
Tmcc1 G C 6: 115,999,071 (GRCm39) R323G possibly damaging Het
Unc13b C T 4: 43,182,842 (GRCm39) R396* probably null Het
Vezt A G 10: 93,806,183 (GRCm39) S743P probably benign Het
Vmn1r77 A C 7: 11,775,659 (GRCm39) N145T probably damaging Het
Vmn2r98 A C 17: 19,285,665 (GRCm39) T162P probably benign Het
Other mutations in Erbb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Erbb4 APN 1 68,110,789 (GRCm39) nonsense probably null
IGL01020:Erbb4 APN 1 68,337,608 (GRCm39) splice site probably benign
IGL01349:Erbb4 APN 1 68,385,752 (GRCm39) missense probably benign 0.00
IGL01386:Erbb4 APN 1 68,383,090 (GRCm39) missense probably damaging 1.00
IGL01516:Erbb4 APN 1 68,367,404 (GRCm39) nonsense probably null
IGL01536:Erbb4 APN 1 68,329,441 (GRCm39) missense probably benign 0.00
IGL01721:Erbb4 APN 1 68,293,722 (GRCm39) missense possibly damaging 0.46
IGL01832:Erbb4 APN 1 68,293,725 (GRCm39) missense possibly damaging 0.84
IGL02002:Erbb4 APN 1 68,119,885 (GRCm39) missense probably damaging 1.00
IGL02040:Erbb4 APN 1 68,081,694 (GRCm39) missense probably damaging 1.00
IGL02371:Erbb4 APN 1 68,329,453 (GRCm39) missense probably benign 0.00
IGL02399:Erbb4 APN 1 68,081,596 (GRCm39) splice site probably benign
IGL02553:Erbb4 APN 1 68,345,023 (GRCm39) missense probably benign 0.17
IGL03118:Erbb4 APN 1 68,081,878 (GRCm39) missense probably benign 0.11
IGL03329:Erbb4 APN 1 68,367,281 (GRCm39) missense probably benign 0.30
IGL03405:Erbb4 APN 1 68,369,397 (GRCm39) missense probably benign 0.02
earthworm UTSW 1 68,289,739 (GRCm39) missense possibly damaging 0.67
excrescence UTSW 1 68,369,405 (GRCm39) missense probably damaging 1.00
Mole UTSW 1 68,599,735 (GRCm39) missense probably damaging 1.00
P0018:Erbb4 UTSW 1 68,110,835 (GRCm39) missense probably benign 0.05
PIT4480001:Erbb4 UTSW 1 68,114,702 (GRCm39) missense probably damaging 1.00
R0193:Erbb4 UTSW 1 68,083,119 (GRCm39) intron probably benign
R0329:Erbb4 UTSW 1 68,337,439 (GRCm39) splice site probably benign
R0335:Erbb4 UTSW 1 68,298,418 (GRCm39) missense probably benign
R0362:Erbb4 UTSW 1 68,369,429 (GRCm39) missense probably damaging 0.99
R0579:Erbb4 UTSW 1 68,081,621 (GRCm39) missense probably benign 0.17
R0730:Erbb4 UTSW 1 68,298,449 (GRCm39) missense probably damaging 0.98
R1029:Erbb4 UTSW 1 68,348,773 (GRCm39) missense probably damaging 0.96
R1444:Erbb4 UTSW 1 68,293,759 (GRCm39) missense probably damaging 1.00
R1469:Erbb4 UTSW 1 68,599,841 (GRCm39) missense probably damaging 0.99
R1469:Erbb4 UTSW 1 68,599,841 (GRCm39) missense probably damaging 0.99
R1503:Erbb4 UTSW 1 68,385,705 (GRCm39) missense probably benign 0.00
R1523:Erbb4 UTSW 1 68,435,411 (GRCm39) missense possibly damaging 0.95
R1528:Erbb4 UTSW 1 68,117,741 (GRCm39) nonsense probably null
R1604:Erbb4 UTSW 1 68,385,728 (GRCm39) missense possibly damaging 0.88
R1611:Erbb4 UTSW 1 68,079,547 (GRCm39) missense probably damaging 1.00
R1642:Erbb4 UTSW 1 68,370,393 (GRCm39) missense probably damaging 1.00
R1905:Erbb4 UTSW 1 68,114,569 (GRCm39) splice site probably benign
R1929:Erbb4 UTSW 1 68,238,047 (GRCm39) missense probably damaging 0.98
R2046:Erbb4 UTSW 1 68,337,482 (GRCm39) missense probably benign 0.02
R2139:Erbb4 UTSW 1 68,385,788 (GRCm39) missense probably damaging 0.96
R2271:Erbb4 UTSW 1 68,238,047 (GRCm39) missense probably damaging 0.98
R2298:Erbb4 UTSW 1 68,081,690 (GRCm39) missense probably damaging 1.00
R2356:Erbb4 UTSW 1 68,117,755 (GRCm39) missense probably benign 0.00
R3821:Erbb4 UTSW 1 68,345,072 (GRCm39) missense probably damaging 0.97
R4007:Erbb4 UTSW 1 68,779,560 (GRCm39) missense probably damaging 1.00
R4012:Erbb4 UTSW 1 68,599,735 (GRCm39) missense probably damaging 1.00
R4077:Erbb4 UTSW 1 68,079,496 (GRCm39) missense probably benign 0.07
R4196:Erbb4 UTSW 1 68,383,014 (GRCm39) missense possibly damaging 0.90
R4536:Erbb4 UTSW 1 68,385,781 (GRCm39) missense probably damaging 1.00
R4561:Erbb4 UTSW 1 68,383,080 (GRCm39) nonsense probably null
R4642:Erbb4 UTSW 1 68,289,791 (GRCm39) missense probably damaging 1.00
R4737:Erbb4 UTSW 1 68,383,059 (GRCm39) missense probably damaging 0.98
R4739:Erbb4 UTSW 1 68,383,059 (GRCm39) missense probably damaging 0.98
R4780:Erbb4 UTSW 1 68,337,473 (GRCm39) missense probably damaging 1.00
R4801:Erbb4 UTSW 1 68,369,405 (GRCm39) missense probably damaging 1.00
R4802:Erbb4 UTSW 1 68,369,405 (GRCm39) missense probably damaging 1.00
R4811:Erbb4 UTSW 1 68,293,703 (GRCm39) missense probably damaging 1.00
R4832:Erbb4 UTSW 1 68,369,397 (GRCm39) missense probably benign 0.02
R5068:Erbb4 UTSW 1 68,083,061 (GRCm39) splice site probably null
R5546:Erbb4 UTSW 1 68,337,452 (GRCm39) missense probably damaging 0.99
R5755:Erbb4 UTSW 1 68,599,678 (GRCm39) missense possibly damaging 0.96
R6189:Erbb4 UTSW 1 68,083,075 (GRCm39) missense probably benign
R6257:Erbb4 UTSW 1 68,435,432 (GRCm39) missense probably damaging 1.00
R6276:Erbb4 UTSW 1 68,599,735 (GRCm39) missense probably damaging 1.00
R6521:Erbb4 UTSW 1 68,081,689 (GRCm39) missense probably damaging 1.00
R6602:Erbb4 UTSW 1 68,409,662 (GRCm39) missense probably damaging 0.99
R6808:Erbb4 UTSW 1 68,079,462 (GRCm39) missense probably benign 0.00
R7087:Erbb4 UTSW 1 68,779,650 (GRCm39) missense probably null 1.00
R7215:Erbb4 UTSW 1 68,378,619 (GRCm39) missense probably benign
R7356:Erbb4 UTSW 1 68,378,514 (GRCm39) critical splice donor site probably null
R7509:Erbb4 UTSW 1 68,289,739 (GRCm39) missense possibly damaging 0.67
R7593:Erbb4 UTSW 1 68,293,758 (GRCm39) missense probably damaging 0.99
R7743:Erbb4 UTSW 1 68,367,278 (GRCm39) missense probably benign 0.00
R7784:Erbb4 UTSW 1 68,114,658 (GRCm39) missense probably damaging 1.00
R7815:Erbb4 UTSW 1 68,081,885 (GRCm39) missense probably damaging 1.00
R7923:Erbb4 UTSW 1 68,298,368 (GRCm39) missense probably damaging 1.00
R8071:Erbb4 UTSW 1 68,435,470 (GRCm39) missense probably damaging 1.00
R8288:Erbb4 UTSW 1 68,337,509 (GRCm39) missense probably damaging 1.00
R8356:Erbb4 UTSW 1 68,110,789 (GRCm39) missense probably damaging 1.00
R8456:Erbb4 UTSW 1 68,110,789 (GRCm39) missense probably damaging 1.00
R8464:Erbb4 UTSW 1 68,348,785 (GRCm39) missense probably benign
R8783:Erbb4 UTSW 1 68,079,331 (GRCm39) missense possibly damaging 0.95
R8830:Erbb4 UTSW 1 68,114,627 (GRCm39) missense probably damaging 1.00
R8881:Erbb4 UTSW 1 68,382,997 (GRCm39) critical splice donor site probably null
R9053:Erbb4 UTSW 1 68,289,779 (GRCm39) missense possibly damaging 0.63
R9142:Erbb4 UTSW 1 68,388,552 (GRCm39) missense probably damaging 1.00
R9237:Erbb4 UTSW 1 68,081,601 (GRCm39) missense possibly damaging 0.72
R9350:Erbb4 UTSW 1 68,329,638 (GRCm39) missense probably benign 0.00
R9374:Erbb4 UTSW 1 68,779,642 (GRCm39) nonsense probably null
R9434:Erbb4 UTSW 1 68,081,773 (GRCm39) missense possibly damaging 0.84
R9499:Erbb4 UTSW 1 68,779,642 (GRCm39) nonsense probably null
R9551:Erbb4 UTSW 1 68,779,642 (GRCm39) nonsense probably null
X0019:Erbb4 UTSW 1 68,112,304 (GRCm39) missense probably benign 0.00
Z1176:Erbb4 UTSW 1 68,367,418 (GRCm39) nonsense probably null
Z1176:Erbb4 UTSW 1 68,337,561 (GRCm39) frame shift probably null
Z1177:Erbb4 UTSW 1 68,348,802 (GRCm39) missense probably benign 0.06
Z1177:Erbb4 UTSW 1 68,329,635 (GRCm39) missense probably damaging 1.00
Z1177:Erbb4 UTSW 1 68,298,342 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GATCCATGGTCTACAGCAAAGTAC -3'
(R):5'- ACTGAGGAATGCTGAGTTGAAGTTATG -3'

Sequencing Primer
(F):5'- TGTTCAAAGCTACGGCA -3'
(R):5'- TGCTGAGTTGAAGTTATGATATTCTG -3'
Posted On 2022-11-14