Incidental Mutation 'R9753:Gprc6a'
ID 732640
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene Name G protein-coupled receptor, family C, group 6, member A
Synonyms
Accession Numbers

Ncbi RefSeq: NM_153071.1; MGI:2429498

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9753 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 51614823-51631461 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 51628268 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 160 (N160S)
Ref Sequence ENSEMBL: ENSMUSP00000020062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
AlphaFold Q8K4Z6
Predicted Effect probably benign
Transcript: ENSMUST00000020062
AA Change: N160S

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: N160S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218684
AA Change: N160S

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000219286
AA Change: N160S

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype Strain: 3831176
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 G A 10: 41,383,500 V843I Het
Bbs12 T C 3: 37,319,531 C43R possibly damaging Het
Brwd1 T C 16: 96,023,828 E1145G probably damaging Het
C2cd4c A C 10: 79,612,233 I360S probably damaging Het
Carmil2 A G 8: 105,690,907 N599S probably damaging Het
Cd79b A G 11: 106,312,631 probably null Het
Ces2c A G 8: 104,853,617 M489V probably benign Het
Clip4 A G 17: 71,799,073 N84D probably benign Het
Cramp1l T C 17: 24,972,346 D1047G possibly damaging Het
Cyp2c69 C T 19: 39,877,547 V201M probably benign Het
Dock2 A G 11: 34,273,673 S1154P possibly damaging Het
Elk4 T G 1: 132,018,143 V253G probably benign Het
Erbb4 T A 1: 68,198,903 H809L probably benign Het
Ext1 A T 15: 53,344,671 D231E probably damaging Het
Fam221b T C 4: 43,665,574 K295E probably benign Het
Fbrsl1 A G 5: 110,378,969 F2L unknown Het
Fnip2 C T 3: 79,508,104 R209H probably benign Het
Gart C T 16: 91,634,061 G371D probably damaging Het
Gata6 T A 18: 11,064,706 V506D possibly damaging Het
Gba2 T C 4: 43,568,716 Y620C probably damaging Het
Gm8857 A T 5: 10,949,053 T53S Het
Gstm3 A G 3: 107,968,177 W46R probably damaging Het
Hcn4 G A 9: 58,844,036 R315H unknown Het
Hydin T C 8: 110,490,766 F1429L possibly damaging Het
Iqgap3 C A 3: 88,108,869 F986L probably damaging Het
Itgb1bp1 A G 12: 21,276,889 S28P unknown Het
Krt10 A G 11: 99,388,966 F123L unknown Het
Krt79 T G 15: 101,930,761 E424D probably benign Het
Lingo4 C T 3: 94,402,186 R144* probably null Het
Ltbr G A 6: 125,307,385 R365W probably damaging Het
Nrsn1 C A 13: 25,253,580 V122L probably benign Het
Olfr1428 T A 19: 12,108,692 M59L probably benign Het
Olfr1564 C A 17: 33,215,714 G210V possibly damaging Het
Olfr456 T C 6: 42,486,573 M207V probably benign Het
Pcgf6 T C 19: 47,034,634 T353A probably damaging Het
Pcsk2 T C 2: 143,793,230 Y342H probably damaging Het
Pou2af1 A T 9: 51,238,336 N243Y possibly damaging Het
Prkcz T C 4: 155,293,202 D197G probably benign Het
Sec14l4 G A 11: 4,039,982 E94K probably benign Het
Sik2 T C 9: 50,895,839 E757G probably damaging Het
Sipa1l1 T A 12: 82,416,989 S1154T possibly damaging Het
Ssb T C 2: 69,867,521 Y175H probably damaging Het
St6galnac6 T C 2: 32,612,249 I50T probably benign Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,301,649 probably benign Het
Tmcc1 G C 6: 116,022,110 R323G possibly damaging Het
Unc13b C T 4: 43,182,842 R396* probably null Het
Vezt A G 10: 93,970,321 S743P probably benign Het
Vmn1r77 A C 7: 12,041,732 N145T probably damaging Het
Vmn2r98 A C 17: 19,065,403 T162P probably benign Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51615430 missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51627084 missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51626723 missense probably benign
IGL02317:Gprc6a APN 10 51620953 missense probably benign 0.01
IGL02995:Gprc6a APN 10 51626799 missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51616603 missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51628349 missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51615872 missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51615259 missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51628437 missense probably benign 0.01
R1831:Gprc6a UTSW 10 51615806 missense probably benign 0.22
R2108:Gprc6a UTSW 10 51615208 missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51615680 frame shift probably null
R2160:Gprc6a UTSW 10 51615680 frame shift probably null
R2162:Gprc6a UTSW 10 51615680 frame shift probably null
R2229:Gprc6a UTSW 10 51626795 missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51628296 missense probably benign 0.02
R3709:Gprc6a UTSW 10 51615680 frame shift probably null
R3710:Gprc6a UTSW 10 51615680 frame shift probably null
R3737:Gprc6a UTSW 10 51626911 missense probably benign
R3914:Gprc6a UTSW 10 51628275 missense probably benign 0.00
R3918:Gprc6a UTSW 10 51615680 frame shift probably null
R3964:Gprc6a UTSW 10 51615680 frame shift probably null
R3965:Gprc6a UTSW 10 51615680 frame shift probably null
R3966:Gprc6a UTSW 10 51615680 frame shift probably null
R3973:Gprc6a UTSW 10 51628448 missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3978:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3979:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R4306:Gprc6a UTSW 10 51616639 missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4405:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4408:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4713:Gprc6a UTSW 10 51631457 unclassified probably benign
R4788:Gprc6a UTSW 10 51615008 missense probably benign 0.00
R5248:Gprc6a UTSW 10 51614993 missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51626804 missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51626702 missense probably benign
R5721:Gprc6a UTSW 10 51614980 missense probably benign 0.06
R6061:Gprc6a UTSW 10 51615811 missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51615077 missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51615260 missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51614912 missense probably benign 0.44
R6207:Gprc6a UTSW 10 51626835 missense probably benign 0.36
R6497:Gprc6a UTSW 10 51615701 missense probably benign 0.05
R6717:Gprc6a UTSW 10 51615137 missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51631316 missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51626745 nonsense probably null
R7000:Gprc6a UTSW 10 51615047 missense probably benign 0.34
R7019:Gprc6a UTSW 10 51631412 missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51614890 missense probably benign
R7173:Gprc6a UTSW 10 51628499 missense probably benign 0.01
R7579:Gprc6a UTSW 10 51626787 missense probably benign
R7736:Gprc6a UTSW 10 51615453 missense possibly damaging 0.82
R7920:Gprc6a UTSW 10 51614930 missense probably benign 0.02
R8273:Gprc6a UTSW 10 51631274 missense probably benign
R8329:Gprc6a UTSW 10 51627259 nonsense probably null
R8517:Gprc6a UTSW 10 51631241 missense probably benign 0.00
R8723:Gprc6a UTSW 10 51615422 missense probably damaging 1.00
R8815:Gprc6a UTSW 10 51620983 missense probably benign 0.00
R8829:Gprc6a UTSW 10 51615199 missense probably damaging 0.99
R9151:Gprc6a UTSW 10 51621086 missense possibly damaging 0.94
R9420:Gprc6a UTSW 10 51615410 missense probably damaging 0.99
R9766:Gprc6a UTSW 10 51615788 missense probably damaging 1.00
R9790:Gprc6a UTSW 10 51615299 missense probably damaging 0.98
R9791:Gprc6a UTSW 10 51615299 missense probably damaging 0.98
Z1177:Gprc6a UTSW 10 51615209 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTAATAGCAAATGTGATGGATAGAC -3'
(R):5'- TGTACCGAAGTCACAGCAGC -3'

Sequencing Primer
(F):5'- GGGGAATCATACGGTCTCATACC -3'
(R):5'- CAATGGCTGCCACTCTGAG -3'
Posted On 2022-11-14