Mutagenetix > Incidental Mutation

Incidental Mutation 'R9753:Ext1'

732650

Institutional Source

Beutler Lab

Gene Symbol

Ext1

Ensembl Gene

ENSMUSG00000061731

Gene Name

exostoses (multiple) 1

Synonyms

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R9753 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

53064038-53346159 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 53344671 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 231 (D231E)

Ref Sequence

ENSEMBL: ENSMUSP00000076505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077273] [ENSMUST00000133362]

AlphaFold

P97464

Predicted Effect

probably damaging
Transcript: ENSMUST00000077273
AA Change: D231E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000076505
Gene: ENSMUSG00000061731
AA Change: D231E

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
low complexity region	29	41	N/A	INTRINSIC
Pfam:Exostosin	110	396	6e-64	PFAM
Pfam:Glyco_transf_64	480	729	1.1e-106	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000133362

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 99.2%
20x: 98.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum-resident type II transmembrane glycosyltransferase involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type I form of multiple exostoses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a lethal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ak9	G	A	10: 41,383,500	V843I		Het
Bbs12	T	C	3: 37,319,531	C43R	possibly damaging	Het
Brwd1	T	C	16: 96,023,828	E1145G	probably damaging	Het
C2cd4c	A	C	10: 79,612,233	I360S	probably damaging	Het
Carmil2	A	G	8: 105,690,907	N599S	probably damaging	Het
Cd79b	A	G	11: 106,312,631		probably null	Het
Ces2c	A	G	8: 104,853,617	M489V	probably benign	Het
Clip4	A	G	17: 71,799,073	N84D	probably benign	Het
Cramp1l	T	C	17: 24,972,346	D1047G	possibly damaging	Het
Cyp2c69	C	T	19: 39,877,547	V201M	probably benign	Het
Dock2	A	G	11: 34,273,673	S1154P	possibly damaging	Het
Elk4	T	G	1: 132,018,143	V253G	probably benign	Het
Erbb4	T	A	1: 68,198,903	H809L	probably benign	Het
Fam221b	T	C	4: 43,665,574	K295E	probably benign	Het
Fbrsl1	A	G	5: 110,378,969	F2L	unknown	Het
Fnip2	C	T	3: 79,508,104	R209H	probably benign	Het
Gart	C	T	16: 91,634,061	G371D	probably damaging	Het
Gata6	T	A	18: 11,064,706	V506D	possibly damaging	Het
Gba2	T	C	4: 43,568,716	Y620C	probably damaging	Het
Gm8857	A	T	5: 10,949,053	T53S		Het
Gprc6a	T	C	10: 51,628,268	N160S	probably benign	Het
Gstm3	A	G	3: 107,968,177	W46R	probably damaging	Het
Hcn4	G	A	9: 58,844,036	R315H	unknown	Het
Hydin	T	C	8: 110,490,766	F1429L	possibly damaging	Het
Iqgap3	C	A	3: 88,108,869	F986L	probably damaging	Het
Itgb1bp1	A	G	12: 21,276,889	S28P	unknown	Het
Krt10	A	G	11: 99,388,966	F123L	unknown	Het
Krt79	T	G	15: 101,930,761	E424D	probably benign	Het
Lingo4	C	T	3: 94,402,186	R144*	probably null	Het
Ltbr	G	A	6: 125,307,385	R365W	probably damaging	Het
Nrsn1	C	A	13: 25,253,580	V122L	probably benign	Het
Olfr1428	T	A	19: 12,108,692	M59L	probably benign	Het
Olfr1564	C	A	17: 33,215,714	G210V	possibly damaging	Het
Olfr456	T	C	6: 42,486,573	M207V	probably benign	Het
Pcgf6	T	C	19: 47,034,634	T353A	probably damaging	Het
Pcsk2	T	C	2: 143,793,230	Y342H	probably damaging	Het
Pou2af1	A	T	9: 51,238,336	N243Y	possibly damaging	Het
Prkcz	T	C	4: 155,293,202	D197G	probably benign	Het
Sec14l4	G	A	11: 4,039,982	E94K	probably benign	Het
Sik2	T	C	9: 50,895,839	E757G	probably damaging	Het
Sipa1l1	T	A	12: 82,416,989	S1154T	possibly damaging	Het
Ssb	T	C	2: 69,867,521	Y175H	probably damaging	Het
St6galnac6	T	C	2: 32,612,249	I50T	probably benign	Het
Styk1	CTCTTCATGATTTTCTT	CTCTT	6: 131,301,649		probably benign	Het
Tmcc1	G	C	6: 116,022,110	R323G	possibly damaging	Het
Unc13b	C	T	4: 43,182,842	R396*	probably null	Het
Vezt	A	G	10: 93,970,321	S743P	probably benign	Het
Vmn1r77	A	C	7: 12,041,732	N145T	probably damaging	Het
Vmn2r98	A	C	17: 19,065,403	T162P	probably benign	Het

Other mutations in Ext1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00710:Ext1	APN	15	53344873	missense	probably damaging	1.00
IGL02081:Ext1	APN	15	53073446	nonsense	probably null
IGL03147:Ext1	UTSW	15	53088072	missense	probably damaging	0.98
R0047:Ext1	UTSW	15	53345146	missense	probably benign
R0047:Ext1	UTSW	15	53345146	missense	probably benign
R0437:Ext1	UTSW	15	53106106	missense	probably damaging	1.00
R0881:Ext1	UTSW	15	53344483	missense	probably benign	0.23
R1882:Ext1	UTSW	15	53075792	missense	probably damaging	1.00
R2135:Ext1	UTSW	15	53101744	missense	possibly damaging	0.88
R2175:Ext1	UTSW	15	53068728	missense	probably damaging	1.00
R2762:Ext1	UTSW	15	53344927	missense	probably benign	0.29
R3162:Ext1	UTSW	15	53344604	missense	possibly damaging	0.82
R3162:Ext1	UTSW	15	53344604	missense	possibly damaging	0.82
R3752:Ext1	UTSW	15	53075910	missense	probably damaging	1.00
R3815:Ext1	UTSW	15	53345089	missense	probably benign	0.05
R4096:Ext1	UTSW	15	53073357	missense	probably damaging	1.00
R4298:Ext1	UTSW	15	53345125	missense	probably benign	0.02
R4362:Ext1	UTSW	15	53107591	intron	probably benign
R4550:Ext1	UTSW	15	53101786	missense	probably damaging	0.99
R4647:Ext1	UTSW	15	53089987	missense	possibly damaging	0.95
R4648:Ext1	UTSW	15	53089987	missense	possibly damaging	0.95
R4871:Ext1	UTSW	15	53092377	missense	probably benign	0.37
R4954:Ext1	UTSW	15	53344492	missense	probably damaging	1.00
R5010:Ext1	UTSW	15	53092412	missense	probably damaging	1.00
R5153:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5155:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5328:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5385:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5542:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5555:Ext1	UTSW	15	53088143	missense	probably damaging	1.00
R5779:Ext1	UTSW	15	53344553	missense	probably damaging	0.99
R5874:Ext1	UTSW	15	53101752	missense	possibly damaging	0.61
R6401:Ext1	UTSW	15	53106097	missense	possibly damaging	0.94
R6604:Ext1	UTSW	15	53083159	missense	probably damaging	0.99
R6847:Ext1	UTSW	15	53345154	missense	probably benign
R6885:Ext1	UTSW	15	53101692	missense	probably damaging	1.00
R7212:Ext1	UTSW	15	53345162	missense	probably benign	0.00
R7315:Ext1	UTSW	15	53073387	missense	probably damaging	1.00
R7361:Ext1	UTSW	15	53344723	missense	probably damaging	1.00
R7474:Ext1	UTSW	15	53344489	missense	probably damaging	0.98
R7853:Ext1	UTSW	15	53107485	missense	probably damaging	0.96
R7860:Ext1	UTSW	15	53089939	missense	possibly damaging	0.84
R8013:Ext1	UTSW	15	53075887	missense	possibly damaging	0.78
R8014:Ext1	UTSW	15	53075887	missense	possibly damaging	0.78
R8725:Ext1	UTSW	15	53344669	missense	possibly damaging	0.91
R8888:Ext1	UTSW	15	53092327	missense	probably damaging	1.00
R9162:Ext1	UTSW	15	53345108	nonsense	probably null
R9342:Ext1	UTSW	15	53345128	missense	probably benign
R9587:Ext1	UTSW	15	53092412	missense	possibly damaging	0.53
R9663:Ext1	UTSW	15	53345060	missense	probably damaging	0.96
X0021:Ext1	UTSW	15	53345273	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGAATCCTTGTGCTTTTGCCAG -3'
(R):5'- ATCCAAAGTGCAGAGTCTCC -3'

Sequencing Primer
(F):5'- AAGACGTCCTCCCCGTTATGG -3'
(R):5'- AAGTGCAGAGTCTCCACTTG -3'

Posted On

2022-11-14