Incidental Mutation 'R9753:Ext1'
ID 732650
Institutional Source Beutler Lab
Gene Symbol Ext1
Ensembl Gene ENSMUSG00000061731
Gene Name exostoses (multiple) 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9753 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 53064038-53346159 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 53344671 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 231 (D231E)
Ref Sequence ENSEMBL: ENSMUSP00000076505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077273] [ENSMUST00000133362]
AlphaFold P97464
Predicted Effect probably damaging
Transcript: ENSMUST00000077273
AA Change: D231E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076505
Gene: ENSMUSG00000061731
AA Change: D231E

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 29 41 N/A INTRINSIC
Pfam:Exostosin 110 396 6e-64 PFAM
Pfam:Glyco_transf_64 480 729 1.1e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133362
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum-resident type II transmembrane glycosyltransferase involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type I form of multiple exostoses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a lethal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 G A 10: 41,383,500 V843I Het
Bbs12 T C 3: 37,319,531 C43R possibly damaging Het
Brwd1 T C 16: 96,023,828 E1145G probably damaging Het
C2cd4c A C 10: 79,612,233 I360S probably damaging Het
Carmil2 A G 8: 105,690,907 N599S probably damaging Het
Cd79b A G 11: 106,312,631 probably null Het
Ces2c A G 8: 104,853,617 M489V probably benign Het
Clip4 A G 17: 71,799,073 N84D probably benign Het
Cramp1l T C 17: 24,972,346 D1047G possibly damaging Het
Cyp2c69 C T 19: 39,877,547 V201M probably benign Het
Dock2 A G 11: 34,273,673 S1154P possibly damaging Het
Elk4 T G 1: 132,018,143 V253G probably benign Het
Erbb4 T A 1: 68,198,903 H809L probably benign Het
Fam221b T C 4: 43,665,574 K295E probably benign Het
Fbrsl1 A G 5: 110,378,969 F2L unknown Het
Fnip2 C T 3: 79,508,104 R209H probably benign Het
Gart C T 16: 91,634,061 G371D probably damaging Het
Gata6 T A 18: 11,064,706 V506D possibly damaging Het
Gba2 T C 4: 43,568,716 Y620C probably damaging Het
Gm8857 A T 5: 10,949,053 T53S Het
Gprc6a T C 10: 51,628,268 N160S probably benign Het
Gstm3 A G 3: 107,968,177 W46R probably damaging Het
Hcn4 G A 9: 58,844,036 R315H unknown Het
Hydin T C 8: 110,490,766 F1429L possibly damaging Het
Iqgap3 C A 3: 88,108,869 F986L probably damaging Het
Itgb1bp1 A G 12: 21,276,889 S28P unknown Het
Krt10 A G 11: 99,388,966 F123L unknown Het
Krt79 T G 15: 101,930,761 E424D probably benign Het
Lingo4 C T 3: 94,402,186 R144* probably null Het
Ltbr G A 6: 125,307,385 R365W probably damaging Het
Nrsn1 C A 13: 25,253,580 V122L probably benign Het
Olfr1428 T A 19: 12,108,692 M59L probably benign Het
Olfr1564 C A 17: 33,215,714 G210V possibly damaging Het
Olfr456 T C 6: 42,486,573 M207V probably benign Het
Pcgf6 T C 19: 47,034,634 T353A probably damaging Het
Pcsk2 T C 2: 143,793,230 Y342H probably damaging Het
Pou2af1 A T 9: 51,238,336 N243Y possibly damaging Het
Prkcz T C 4: 155,293,202 D197G probably benign Het
Sec14l4 G A 11: 4,039,982 E94K probably benign Het
Sik2 T C 9: 50,895,839 E757G probably damaging Het
Sipa1l1 T A 12: 82,416,989 S1154T possibly damaging Het
Ssb T C 2: 69,867,521 Y175H probably damaging Het
St6galnac6 T C 2: 32,612,249 I50T probably benign Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,301,649 probably benign Het
Tmcc1 G C 6: 116,022,110 R323G possibly damaging Het
Unc13b C T 4: 43,182,842 R396* probably null Het
Vezt A G 10: 93,970,321 S743P probably benign Het
Vmn1r77 A C 7: 12,041,732 N145T probably damaging Het
Vmn2r98 A C 17: 19,065,403 T162P probably benign Het
Other mutations in Ext1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Ext1 APN 15 53344873 missense probably damaging 1.00
IGL02081:Ext1 APN 15 53073446 nonsense probably null
IGL03147:Ext1 UTSW 15 53088072 missense probably damaging 0.98
R0047:Ext1 UTSW 15 53345146 missense probably benign
R0047:Ext1 UTSW 15 53345146 missense probably benign
R0437:Ext1 UTSW 15 53106106 missense probably damaging 1.00
R0881:Ext1 UTSW 15 53344483 missense probably benign 0.23
R1882:Ext1 UTSW 15 53075792 missense probably damaging 1.00
R2135:Ext1 UTSW 15 53101744 missense possibly damaging 0.88
R2175:Ext1 UTSW 15 53068728 missense probably damaging 1.00
R2762:Ext1 UTSW 15 53344927 missense probably benign 0.29
R3162:Ext1 UTSW 15 53344604 missense possibly damaging 0.82
R3162:Ext1 UTSW 15 53344604 missense possibly damaging 0.82
R3752:Ext1 UTSW 15 53075910 missense probably damaging 1.00
R3815:Ext1 UTSW 15 53345089 missense probably benign 0.05
R4096:Ext1 UTSW 15 53073357 missense probably damaging 1.00
R4298:Ext1 UTSW 15 53345125 missense probably benign 0.02
R4362:Ext1 UTSW 15 53107591 intron probably benign
R4550:Ext1 UTSW 15 53101786 missense probably damaging 0.99
R4647:Ext1 UTSW 15 53089987 missense possibly damaging 0.95
R4648:Ext1 UTSW 15 53089987 missense possibly damaging 0.95
R4871:Ext1 UTSW 15 53092377 missense probably benign 0.37
R4954:Ext1 UTSW 15 53344492 missense probably damaging 1.00
R5010:Ext1 UTSW 15 53092412 missense probably damaging 1.00
R5153:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5155:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5328:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5385:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5542:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5555:Ext1 UTSW 15 53088143 missense probably damaging 1.00
R5779:Ext1 UTSW 15 53344553 missense probably damaging 0.99
R5874:Ext1 UTSW 15 53101752 missense possibly damaging 0.61
R6401:Ext1 UTSW 15 53106097 missense possibly damaging 0.94
R6604:Ext1 UTSW 15 53083159 missense probably damaging 0.99
R6847:Ext1 UTSW 15 53345154 missense probably benign
R6885:Ext1 UTSW 15 53101692 missense probably damaging 1.00
R7212:Ext1 UTSW 15 53345162 missense probably benign 0.00
R7315:Ext1 UTSW 15 53073387 missense probably damaging 1.00
R7361:Ext1 UTSW 15 53344723 missense probably damaging 1.00
R7474:Ext1 UTSW 15 53344489 missense probably damaging 0.98
R7853:Ext1 UTSW 15 53107485 missense probably damaging 0.96
R7860:Ext1 UTSW 15 53089939 missense possibly damaging 0.84
R8013:Ext1 UTSW 15 53075887 missense possibly damaging 0.78
R8014:Ext1 UTSW 15 53075887 missense possibly damaging 0.78
R8725:Ext1 UTSW 15 53344669 missense possibly damaging 0.91
R8888:Ext1 UTSW 15 53092327 missense probably damaging 1.00
R9162:Ext1 UTSW 15 53345108 nonsense probably null
R9342:Ext1 UTSW 15 53345128 missense probably benign
R9587:Ext1 UTSW 15 53092412 missense possibly damaging 0.53
R9663:Ext1 UTSW 15 53345060 missense probably damaging 0.96
X0021:Ext1 UTSW 15 53345273 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAATCCTTGTGCTTTTGCCAG -3'
(R):5'- ATCCAAAGTGCAGAGTCTCC -3'

Sequencing Primer
(F):5'- AAGACGTCCTCCCCGTTATGG -3'
(R):5'- AAGTGCAGAGTCTCCACTTG -3'
Posted On 2022-11-14