Mutagenetix > Incidental Mutation

Incidental Mutation 'R9753:Cramp1l'

732655

Institutional Source

Beutler Lab

Gene Symbol

Cramp1l

Ensembl Gene

ENSMUSG00000038002

Gene Name

cramped chromatin regulator homolog 1

Synonyms

5830477H08Rik, Tce4

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9753 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

24961228-25015230 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 24972346 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1047 (D1047G)

Ref Sequence

ENSEMBL: ENSMUSP00000073060 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073337]

AlphaFold

Q6PG95

Predicted Effect

possibly damaging
Transcript: ENSMUST00000073337
AA Change: D1047G

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000073060
Gene: ENSMUSG00000038002
AA Change: D1047G

Domain	Start	End	E-Value	Type
low complexity region	11	20	N/A	INTRINSIC
low complexity region	29	43	N/A	INTRINSIC
low complexity region	51	64	N/A	INTRINSIC
low complexity region	100	126	N/A	INTRINSIC
low complexity region	134	147	N/A	INTRINSIC
SANT	159	219	3.68e-3	SMART
low complexity region	479	503	N/A	INTRINSIC
low complexity region	548	562	N/A	INTRINSIC
low complexity region	792	803	N/A	INTRINSIC
low complexity region	833	845	N/A	INTRINSIC
low complexity region	889	903	N/A	INTRINSIC
low complexity region	1069	1086	N/A	INTRINSIC
low complexity region	1113	1124	N/A	INTRINSIC
low complexity region	1141	1156	N/A	INTRINSIC
low complexity region	1171	1185	N/A	INTRINSIC

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 99.2%
20x: 98.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ak9	G	A	10: 41,383,500	V843I		Het
Bbs12	T	C	3: 37,319,531	C43R	possibly damaging	Het
Brwd1	T	C	16: 96,023,828	E1145G	probably damaging	Het
C2cd4c	A	C	10: 79,612,233	I360S	probably damaging	Het
Carmil2	A	G	8: 105,690,907	N599S	probably damaging	Het
Cd79b	A	G	11: 106,312,631		probably null	Het
Ces2c	A	G	8: 104,853,617	M489V	probably benign	Het
Clip4	A	G	17: 71,799,073	N84D	probably benign	Het
Cyp2c69	C	T	19: 39,877,547	V201M	probably benign	Het
Dock2	A	G	11: 34,273,673	S1154P	possibly damaging	Het
Elk4	T	G	1: 132,018,143	V253G	probably benign	Het
Erbb4	T	A	1: 68,198,903	H809L	probably benign	Het
Ext1	A	T	15: 53,344,671	D231E	probably damaging	Het
Fam221b	T	C	4: 43,665,574	K295E	probably benign	Het
Fbrsl1	A	G	5: 110,378,969	F2L	unknown	Het
Fnip2	C	T	3: 79,508,104	R209H	probably benign	Het
Gart	C	T	16: 91,634,061	G371D	probably damaging	Het
Gata6	T	A	18: 11,064,706	V506D	possibly damaging	Het
Gba2	T	C	4: 43,568,716	Y620C	probably damaging	Het
Gm8857	A	T	5: 10,949,053	T53S		Het
Gprc6a	T	C	10: 51,628,268	N160S	probably benign	Het
Gstm3	A	G	3: 107,968,177	W46R	probably damaging	Het
Hcn4	G	A	9: 58,844,036	R315H	unknown	Het
Hydin	T	C	8: 110,490,766	F1429L	possibly damaging	Het
Iqgap3	C	A	3: 88,108,869	F986L	probably damaging	Het
Itgb1bp1	A	G	12: 21,276,889	S28P	unknown	Het
Krt10	A	G	11: 99,388,966	F123L	unknown	Het
Krt79	T	G	15: 101,930,761	E424D	probably benign	Het
Lingo4	C	T	3: 94,402,186	R144*	probably null	Het
Ltbr	G	A	6: 125,307,385	R365W	probably damaging	Het
Nrsn1	C	A	13: 25,253,580	V122L	probably benign	Het
Olfr1428	T	A	19: 12,108,692	M59L	probably benign	Het
Olfr1564	C	A	17: 33,215,714	G210V	possibly damaging	Het
Olfr456	T	C	6: 42,486,573	M207V	probably benign	Het
Pcgf6	T	C	19: 47,034,634	T353A	probably damaging	Het
Pcsk2	T	C	2: 143,793,230	Y342H	probably damaging	Het
Pou2af1	A	T	9: 51,238,336	N243Y	possibly damaging	Het
Prkcz	T	C	4: 155,293,202	D197G	probably benign	Het
Sec14l4	G	A	11: 4,039,982	E94K	probably benign	Het
Sik2	T	C	9: 50,895,839	E757G	probably damaging	Het
Sipa1l1	T	A	12: 82,416,989	S1154T	possibly damaging	Het
Ssb	T	C	2: 69,867,521	Y175H	probably damaging	Het
St6galnac6	T	C	2: 32,612,249	I50T	probably benign	Het
Styk1	CTCTTCATGATTTTCTT	CTCTT	6: 131,301,649		probably benign	Het
Tmcc1	G	C	6: 116,022,110	R323G	possibly damaging	Het
Unc13b	C	T	4: 43,182,842	R396*	probably null	Het
Vezt	A	G	10: 93,970,321	S743P	probably benign	Het
Vmn1r77	A	C	7: 12,041,732	N145T	probably damaging	Het
Vmn2r98	A	C	17: 19,065,403	T162P	probably benign	Het

Other mutations in Cramp1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00566:Cramp1l	APN	17	24983951	missense	probably benign	0.11
IGL01360:Cramp1l	APN	17	24997573	missense	probably damaging	1.00
IGL01966:Cramp1l	APN	17	24982943	missense	probably benign	0.01
IGL02211:Cramp1l	APN	17	24977636	missense	possibly damaging	0.94
IGL02474:Cramp1l	APN	17	24985050	missense	probably damaging	0.98
IGL02798:Cramp1l	APN	17	24968920	splice site	probably benign
IGL03340:Cramp1l	APN	17	24973542	missense	probably damaging	1.00
R0106:Cramp1l	UTSW	17	24972376	missense	probably benign	0.30
R1054:Cramp1l	UTSW	17	24983177	missense	probably damaging	1.00
R1220:Cramp1l	UTSW	17	24982237	missense	probably damaging	1.00
R1341:Cramp1l	UTSW	17	24977540	missense	probably damaging	1.00
R1491:Cramp1l	UTSW	17	24972349	missense	probably benign	0.17
R1610:Cramp1l	UTSW	17	24983951	missense	probably benign	0.11
R1649:Cramp1l	UTSW	17	24983243	missense	probably damaging	1.00
R1795:Cramp1l	UTSW	17	24964910	missense	probably damaging	1.00
R1856:Cramp1l	UTSW	17	24968978	missense	probably damaging	1.00
R1881:Cramp1l	UTSW	17	24977682	splice site	probably benign
R1968:Cramp1l	UTSW	17	24964939	missense	probably damaging	1.00
R2047:Cramp1l	UTSW	17	25003215	nonsense	probably null
R2099:Cramp1l	UTSW	17	24973085	missense	probably benign	0.01
R2298:Cramp1l	UTSW	17	24997480	missense	probably damaging	0.96
R3752:Cramp1l	UTSW	17	24971558	missense	probably damaging	1.00
R3821:Cramp1l	UTSW	17	24974782	missense	probably damaging	1.00
R3861:Cramp1l	UTSW	17	24997614	splice site	probably benign
R4399:Cramp1l	UTSW	17	24979585	missense	probably damaging	1.00
R4847:Cramp1l	UTSW	17	24985089	missense	probably damaging	1.00
R4883:Cramp1l	UTSW	17	24982319	missense	probably benign
R5579:Cramp1l	UTSW	17	24973113	missense	possibly damaging	0.89
R5631:Cramp1l	UTSW	17	24985603	missense	possibly damaging	0.93
R5716:Cramp1l	UTSW	17	24974735	missense	probably damaging	0.99
R6589:Cramp1l	UTSW	17	24977492	splice site	probably null
R6631:Cramp1l	UTSW	17	24983957	missense	probably benign	0.40
R7307:Cramp1l	UTSW	17	24974745	missense	possibly damaging	0.94
R7323:Cramp1l	UTSW	17	24982405	missense	possibly damaging	0.90
R7672:Cramp1l	UTSW	17	24982466	missense	probably damaging	0.96
R7832:Cramp1l	UTSW	17	24983222	missense	probably damaging	0.96
R8071:Cramp1l	UTSW	17	24982700	missense	probably damaging	0.99
R8244:Cramp1l	UTSW	17	24971410	missense	probably damaging	1.00
R8430:Cramp1l	UTSW	17	24977562	missense	probably damaging	1.00
R8783:Cramp1l	UTSW	17	24974758	missense	probably damaging	0.99
R8890:Cramp1l	UTSW	17	24983140	missense	probably damaging	1.00
R8892:Cramp1l	UTSW	17	24983140	missense	probably damaging	1.00
R8894:Cramp1l	UTSW	17	24983140	missense	probably damaging	1.00
R8937:Cramp1l	UTSW	17	24983982	missense	probably damaging	0.99
R8941:Cramp1l	UTSW	17	24983140	missense	probably damaging	1.00
R9029:Cramp1l	UTSW	17	25013910	missense	probably damaging	1.00
R9047:Cramp1l	UTSW	17	24979629	missense	possibly damaging	0.90
R9149:Cramp1l	UTSW	17	24968946	missense	probably damaging	0.99
R9262:Cramp1l	UTSW	17	25013946	missense	probably damaging	0.99
R9460:Cramp1l	UTSW	17	25003307	missense	probably damaging	1.00
R9614:Cramp1l	UTSW	17	24982809	missense	probably damaging	1.00
R9615:Cramp1l	UTSW	17	24982809	missense	probably damaging	1.00
R9651:Cramp1l	UTSW	17	24982809	missense	probably damaging	1.00
R9652:Cramp1l	UTSW	17	24982809	missense	probably damaging	1.00
R9653:Cramp1l	UTSW	17	24982809	missense	probably damaging	1.00
R9665:Cramp1l	UTSW	17	24977571	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCACTGTCAGCATCTAGTGGAG -3'
(R):5'- TAGGGACACCGGCTTAACTG -3'

Sequencing Primer
(F):5'- AACCTAGTCCTTTCAGACATGGGG -3'
(R):5'- GGACACCGGCTTAACTGAGAAC -3'

Posted On

2022-11-14