Mutagenetix > Incidental Mutation

Incidental Mutation 'R9753:Gata6'

732658

Institutional Source

Beutler Lab

Gene Symbol

Gata6

Ensembl Gene

ENSMUSG00000005836

Gene Name

GATA binding protein 6

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9753 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

11052508-11085635 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 11064706 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 506 (V506D)

Ref Sequence

ENSEMBL: ENSMUSP00000041774 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047762]

AlphaFold

Q61169

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047762
AA Change: V506D

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000041774
Gene: ENSMUSG00000005836
AA Change: V506D

Domain	Start	End	E-Value	Type
low complexity region	14	29	N/A	INTRINSIC
low complexity region	32	47	N/A	INTRINSIC
low complexity region	84	105	N/A	INTRINSIC
Pfam:GATA-N	147	372	2.3e-62	PFAM
ZnF_GATA	378	429	4.23e-16	SMART
ZnF_GATA	432	482	3.62e-24	SMART

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 99.2%
20x: 98.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a small family of zinc finger transcription factors that play an important role in the regulation of cellular differentiation and organogenesis during vertebrate development. This gene is expressed during early embryogenesis and localizes to endo- and mesodermally derived cells during later embryogenesis and thereby plays an important role in gut, lung, and heart development. Mutations in this gene are associated with several congenital defects. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous null mutant E5.5 embryos lack parts of the visceral endoderm, show impaired embryonic ectoderm development, and die soon post-implantation, apparently of extraembryonic tissue defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ak9	G	A	10: 41,383,500	V843I		Het
Bbs12	T	C	3: 37,319,531	C43R	possibly damaging	Het
Brwd1	T	C	16: 96,023,828	E1145G	probably damaging	Het
C2cd4c	A	C	10: 79,612,233	I360S	probably damaging	Het
Carmil2	A	G	8: 105,690,907	N599S	probably damaging	Het
Cd79b	A	G	11: 106,312,631		probably null	Het
Ces2c	A	G	8: 104,853,617	M489V	probably benign	Het
Clip4	A	G	17: 71,799,073	N84D	probably benign	Het
Cramp1l	T	C	17: 24,972,346	D1047G	possibly damaging	Het
Cyp2c69	C	T	19: 39,877,547	V201M	probably benign	Het
Dock2	A	G	11: 34,273,673	S1154P	possibly damaging	Het
Elk4	T	G	1: 132,018,143	V253G	probably benign	Het
Erbb4	T	A	1: 68,198,903	H809L	probably benign	Het
Ext1	A	T	15: 53,344,671	D231E	probably damaging	Het
Fam221b	T	C	4: 43,665,574	K295E	probably benign	Het
Fbrsl1	A	G	5: 110,378,969	F2L	unknown	Het
Fnip2	C	T	3: 79,508,104	R209H	probably benign	Het
Gart	C	T	16: 91,634,061	G371D	probably damaging	Het
Gba2	T	C	4: 43,568,716	Y620C	probably damaging	Het
Gm8857	A	T	5: 10,949,053	T53S		Het
Gprc6a	T	C	10: 51,628,268	N160S	probably benign	Het
Gstm3	A	G	3: 107,968,177	W46R	probably damaging	Het
Hcn4	G	A	9: 58,844,036	R315H	unknown	Het
Hydin	T	C	8: 110,490,766	F1429L	possibly damaging	Het
Iqgap3	C	A	3: 88,108,869	F986L	probably damaging	Het
Itgb1bp1	A	G	12: 21,276,889	S28P	unknown	Het
Krt10	A	G	11: 99,388,966	F123L	unknown	Het
Krt79	T	G	15: 101,930,761	E424D	probably benign	Het
Lingo4	C	T	3: 94,402,186	R144*	probably null	Het
Ltbr	G	A	6: 125,307,385	R365W	probably damaging	Het
Nrsn1	C	A	13: 25,253,580	V122L	probably benign	Het
Olfr1428	T	A	19: 12,108,692	M59L	probably benign	Het
Olfr1564	C	A	17: 33,215,714	G210V	possibly damaging	Het
Olfr456	T	C	6: 42,486,573	M207V	probably benign	Het
Pcgf6	T	C	19: 47,034,634	T353A	probably damaging	Het
Pcsk2	T	C	2: 143,793,230	Y342H	probably damaging	Het
Pou2af1	A	T	9: 51,238,336	N243Y	possibly damaging	Het
Prkcz	T	C	4: 155,293,202	D197G	probably benign	Het
Sec14l4	G	A	11: 4,039,982	E94K	probably benign	Het
Sik2	T	C	9: 50,895,839	E757G	probably damaging	Het
Sipa1l1	T	A	12: 82,416,989	S1154T	possibly damaging	Het
Ssb	T	C	2: 69,867,521	Y175H	probably damaging	Het
St6galnac6	T	C	2: 32,612,249	I50T	probably benign	Het
Styk1	CTCTTCATGATTTTCTT	CTCTT	6: 131,301,649		probably benign	Het
Tmcc1	G	C	6: 116,022,110	R323G	possibly damaging	Het
Unc13b	C	T	4: 43,182,842	R396*	probably null	Het
Vezt	A	G	10: 93,970,321	S743P	probably benign	Het
Vmn1r77	A	C	7: 12,041,732	N145T	probably damaging	Het
Vmn2r98	A	C	17: 19,065,403	T162P	probably benign	Het

Other mutations in Gata6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00567:Gata6	APN	18	11084330	missense	possibly damaging	0.47
IGL01328:Gata6	APN	18	11064530	missense	probably damaging	0.99
IGL02419:Gata6	APN	18	11054220	missense	probably damaging	1.00
Lutsen	UTSW	18	11063059	missense	possibly damaging	0.65
R0538:Gata6	UTSW	18	11064771	missense	probably benign	0.11
R1419:Gata6	UTSW	18	11064706	missense	probably benign	0.42
R2000:Gata6	UTSW	18	11054113	missense	probably benign	0.04
R3113:Gata6	UTSW	18	11063124	missense	probably damaging	1.00
R4765:Gata6	UTSW	18	11054394	missense	probably benign
R4855:Gata6	UTSW	18	11054497	missense	possibly damaging	0.92
R5368:Gata6	UTSW	18	11063059	missense	possibly damaging	0.65
R6805:Gata6	UTSW	18	11054460	missense	possibly damaging	0.83
R7192:Gata6	UTSW	18	11054475	missense	possibly damaging	0.82
R7206:Gata6	UTSW	18	11054850	missense	probably damaging	1.00
R7501:Gata6	UTSW	18	11054082	missense	probably damaging	0.97
R7541:Gata6	UTSW	18	11059108	missense	probably damaging	1.00
R7736:Gata6	UTSW	18	11084379	missense	probably damaging	1.00
R8029:Gata6	UTSW	18	11054944	missense	possibly damaging	0.68
R8251:Gata6	UTSW	18	11054670	missense	probably benign	0.03
R9339:Gata6	UTSW	18	11054520	missense	probably damaging	0.98
R9712:Gata6	UTSW	18	11059064	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- TGCATGTAAGATCGGTGTGAAC -3'
(R):5'- AGCTGGACCTTAATTAAGAGGTTTG -3'

Sequencing Primer
(F):5'- TAGGTGCCTCGACCACTTG -3'
(R):5'- TGTTGGTTCAGATTATTATACTGCTG -3'

Posted On

2022-11-14