Incidental Mutation 'R9753:Gata6'
ID 732658
Institutional Source Beutler Lab
Gene Symbol Gata6
Ensembl Gene ENSMUSG00000005836
Gene Name GATA binding protein 6
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9753 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 11052510-11085636 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 11064706 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 506 (V506D)
Ref Sequence ENSEMBL: ENSMUSP00000041774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047762]
AlphaFold Q61169
Predicted Effect possibly damaging
Transcript: ENSMUST00000047762
AA Change: V506D

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041774
Gene: ENSMUSG00000005836
AA Change: V506D

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
low complexity region 84 105 N/A INTRINSIC
Pfam:GATA-N 147 372 2.3e-62 PFAM
ZnF_GATA 378 429 4.23e-16 SMART
ZnF_GATA 432 482 3.62e-24 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a small family of zinc finger transcription factors that play an important role in the regulation of cellular differentiation and organogenesis during vertebrate development. This gene is expressed during early embryogenesis and localizes to endo- and mesodermally derived cells during later embryogenesis and thereby plays an important role in gut, lung, and heart development. Mutations in this gene are associated with several congenital defects. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous null mutant E5.5 embryos lack parts of the visceral endoderm, show impaired embryonic ectoderm development, and die soon post-implantation, apparently of extraembryonic tissue defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 G A 10: 41,259,496 (GRCm39) V843I Het
Bbs12 T C 3: 37,373,680 (GRCm39) C43R possibly damaging Het
Brwd1 T C 16: 95,825,028 (GRCm39) E1145G probably damaging Het
C2cd4c A C 10: 79,448,067 (GRCm39) I360S probably damaging Het
Carmil2 A G 8: 106,417,539 (GRCm39) N599S probably damaging Het
Cd79b A G 11: 106,203,457 (GRCm39) probably null Het
Ces2c A G 8: 105,580,249 (GRCm39) M489V probably benign Het
Clip4 A G 17: 72,106,068 (GRCm39) N84D probably benign Het
Cramp1 T C 17: 25,191,320 (GRCm39) D1047G possibly damaging Het
Cyp2c69 C T 19: 39,865,991 (GRCm39) V201M probably benign Het
Dock2 A G 11: 34,223,673 (GRCm39) S1154P possibly damaging Het
Elk4 T G 1: 131,945,881 (GRCm39) V253G probably benign Het
Erbb4 T A 1: 68,238,062 (GRCm39) H809L probably benign Het
Ext1 A T 15: 53,208,067 (GRCm39) D231E probably damaging Het
Fam221b T C 4: 43,665,574 (GRCm39) K295E probably benign Het
Fbrsl1 A G 5: 110,526,835 (GRCm39) F2L unknown Het
Fnip2 C T 3: 79,415,411 (GRCm39) R209H probably benign Het
Gart C T 16: 91,430,949 (GRCm39) G371D probably damaging Het
Gba2 T C 4: 43,568,716 (GRCm39) Y620C probably damaging Het
Gprc6a T C 10: 51,504,364 (GRCm39) N160S probably benign Het
Gstm3 A G 3: 107,875,493 (GRCm39) W46R probably damaging Het
Hcn4 G A 9: 58,751,319 (GRCm39) R315H unknown Het
Hydin T C 8: 111,217,398 (GRCm39) F1429L possibly damaging Het
Iqgap3 C A 3: 88,016,176 (GRCm39) F986L probably damaging Het
Itgb1bp1 A G 12: 21,326,890 (GRCm39) S28P unknown Het
Krt10 A G 11: 99,279,792 (GRCm39) F123L unknown Het
Krt79 T G 15: 101,839,196 (GRCm39) E424D probably benign Het
Lingo4 C T 3: 94,309,493 (GRCm39) R144* probably null Het
Ltbr G A 6: 125,284,348 (GRCm39) R365W probably damaging Het
Nrsn1 C A 13: 25,437,563 (GRCm39) V122L probably benign Het
Or10h5 C A 17: 33,434,688 (GRCm39) G210V possibly damaging Het
Or2r2 T C 6: 42,463,507 (GRCm39) M207V probably benign Het
Or4d6 T A 19: 12,086,056 (GRCm39) M59L probably benign Het
Pcgf6 T C 19: 47,023,073 (GRCm39) T353A probably damaging Het
Pcsk2 T C 2: 143,635,150 (GRCm39) Y342H probably damaging Het
Pou2af1 A T 9: 51,149,636 (GRCm39) N243Y possibly damaging Het
Prkcz T C 4: 155,377,659 (GRCm39) D197G probably benign Het
Sec14l4 G A 11: 3,989,982 (GRCm39) E94K probably benign Het
Sik2 T C 9: 50,807,139 (GRCm39) E757G probably damaging Het
Sipa1l1 T A 12: 82,463,763 (GRCm39) S1154T possibly damaging Het
Speer1k A T 5: 10,999,020 (GRCm39) T53S Het
Ssb T C 2: 69,697,865 (GRCm39) Y175H probably damaging Het
St6galnac6 T C 2: 32,502,261 (GRCm39) I50T probably benign Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,278,612 (GRCm39) probably benign Het
Tmcc1 G C 6: 115,999,071 (GRCm39) R323G possibly damaging Het
Unc13b C T 4: 43,182,842 (GRCm39) R396* probably null Het
Vezt A G 10: 93,806,183 (GRCm39) S743P probably benign Het
Vmn1r77 A C 7: 11,775,659 (GRCm39) N145T probably damaging Het
Vmn2r98 A C 17: 19,285,665 (GRCm39) T162P probably benign Het
Other mutations in Gata6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Gata6 APN 18 11,084,330 (GRCm39) missense possibly damaging 0.47
IGL01328:Gata6 APN 18 11,064,530 (GRCm39) missense probably damaging 0.99
IGL02419:Gata6 APN 18 11,054,220 (GRCm39) missense probably damaging 1.00
Lutsen UTSW 18 11,063,059 (GRCm39) missense possibly damaging 0.65
R0538:Gata6 UTSW 18 11,064,771 (GRCm39) missense probably benign 0.11
R1419:Gata6 UTSW 18 11,064,706 (GRCm39) missense probably benign 0.42
R2000:Gata6 UTSW 18 11,054,113 (GRCm39) missense probably benign 0.04
R3113:Gata6 UTSW 18 11,063,124 (GRCm39) missense probably damaging 1.00
R4765:Gata6 UTSW 18 11,054,394 (GRCm39) missense probably benign
R4855:Gata6 UTSW 18 11,054,497 (GRCm39) missense possibly damaging 0.92
R5368:Gata6 UTSW 18 11,063,059 (GRCm39) missense possibly damaging 0.65
R6805:Gata6 UTSW 18 11,054,460 (GRCm39) missense possibly damaging 0.83
R7192:Gata6 UTSW 18 11,054,475 (GRCm39) missense possibly damaging 0.82
R7206:Gata6 UTSW 18 11,054,850 (GRCm39) missense probably damaging 1.00
R7501:Gata6 UTSW 18 11,054,082 (GRCm39) missense probably damaging 0.97
R7541:Gata6 UTSW 18 11,059,108 (GRCm39) missense probably damaging 1.00
R7736:Gata6 UTSW 18 11,084,379 (GRCm39) missense probably damaging 1.00
R8029:Gata6 UTSW 18 11,054,944 (GRCm39) missense possibly damaging 0.68
R8251:Gata6 UTSW 18 11,054,670 (GRCm39) missense probably benign 0.03
R9339:Gata6 UTSW 18 11,054,520 (GRCm39) missense probably damaging 0.98
R9712:Gata6 UTSW 18 11,059,064 (GRCm39) missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TGCATGTAAGATCGGTGTGAAC -3'
(R):5'- AGCTGGACCTTAATTAAGAGGTTTG -3'

Sequencing Primer
(F):5'- TAGGTGCCTCGACCACTTG -3'
(R):5'- TGTTGGTTCAGATTATTATACTGCTG -3'
Posted On 2022-11-14