Incidental Mutation 'R9755:Miip'
ID 732671
Institutional Source Beutler Lab
Gene Symbol Miip
Ensembl Gene ENSMUSG00000029022
Gene Name migration and invasion inhibitory protein
Synonyms D4Wsu114e
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R9755 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 147945235-147953176 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 147950319 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 92 (Y92*)
Ref Sequence ENSEMBL: ENSMUSP00000113897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030886] [ENSMUST00000094481] [ENSMUST00000119975] [ENSMUST00000172710]
AlphaFold A2A7Y5
Predicted Effect probably null
Transcript: ENSMUST00000030886
AA Change: Y92*
SMART Domains Protein: ENSMUSP00000030886
Gene: ENSMUSG00000029022
AA Change: Y92*

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094481
SMART Domains Protein: ENSMUSP00000092054
Gene: ENSMUSG00000070583

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
coiled coil region 86 116 N/A INTRINSIC
low complexity region 438 451 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119975
AA Change: Y92*
SMART Domains Protein: ENSMUSP00000113897
Gene: ENSMUSG00000029022
AA Change: Y92*

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Pfam:MIIP 41 382 1.4e-142 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000172710
AA Change: Y92*
SMART Domains Protein: ENSMUSP00000134085
Gene: ENSMUSG00000029022
AA Change: Y92*

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.1%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the oncogene protein insulin-like growth factor binding protein 2 and may function as an inhibitor of cell migration and invasion. This protein also interacts with the cell division protein 20 and may be involved in regulating mitotic progression. This protein may function as a tumor suppressor by inhibiting the growth or certain cancers. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,889,292 (GRCm39) M774K probably damaging Het
Adamts9 T C 6: 92,856,922 (GRCm39) R906G probably benign Het
Adgrl4 A T 3: 151,216,418 (GRCm39) T534S probably benign Het
Amph A T 13: 19,297,325 (GRCm39) D357V probably damaging Het
Arhgap33 C T 7: 30,227,926 (GRCm39) V452I possibly damaging Het
B4galnt2 G A 11: 95,774,801 (GRCm39) Q160* probably null Het
C1galt1 T G 6: 7,867,019 (GRCm39) N288K probably benign Het
Cacna1c T C 6: 118,651,559 (GRCm39) D967G probably damaging Het
Cacul1 C T 19: 60,533,955 (GRCm39) E216K probably damaging Het
Cenpq A T 17: 41,243,712 (GRCm39) S45R probably benign Het
Cfap54 T A 10: 92,757,230 (GRCm39) M2216L unknown Het
Cfhr1 A G 1: 139,487,889 (GRCm39) F3S probably benign Het
Csf2rb T G 15: 78,232,824 (GRCm39) Y710* probably null Het
Dhh A G 15: 98,792,939 (GRCm39) V107A possibly damaging Het
Etl4 A T 2: 20,790,048 (GRCm39) T849S probably benign Het
Gnrh1 G A 14: 67,986,699 (GRCm39) E78K possibly damaging Het
Golga3 A G 5: 110,340,847 (GRCm39) T514A probably benign Het
Gramd1c T A 16: 43,803,879 (GRCm39) K393N probably benign Het
Kcp T C 6: 29,492,460 (GRCm39) Y844C probably damaging Het
Lrrc15 T A 16: 30,093,147 (GRCm39) H64L possibly damaging Het
Mak G T 13: 41,199,623 (GRCm39) Q339K probably benign Het
Mdfic G T 6: 15,799,758 (GRCm39) C295F probably damaging Het
Mdfic2 A T 6: 98,225,147 (GRCm39) N45K probably benign Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mycbp2 A T 14: 103,551,806 (GRCm39) S175T probably benign Het
Nacad A G 11: 6,549,374 (GRCm39) probably null Het
Ndnf T G 6: 65,680,502 (GRCm39) D260E probably benign Het
Nphp1 G A 2: 127,595,951 (GRCm39) Q505* probably null Het
Or12e7 C A 2: 87,287,719 (GRCm39) A70E probably damaging Het
Or8g29-ps1 A G 9: 39,200,970 (GRCm39) V72A possibly damaging Het
Plcg1 G A 2: 160,573,780 (GRCm39) G15D probably benign Het
Ppm1h A G 10: 122,638,165 (GRCm39) Y145C probably damaging Het
Prickle2 C T 6: 92,399,319 (GRCm39) C186Y probably damaging Het
Prmt6 A C 3: 110,157,359 (GRCm39) L310R probably damaging Het
Psg25 A T 7: 18,260,460 (GRCm39) I146N probably benign Het
Sapcd1 A G 17: 35,245,400 (GRCm39) S128P probably benign Het
Scart2 T A 7: 139,841,544 (GRCm39) probably null Het
Sema3b T C 9: 107,478,784 (GRCm39) S331G probably damaging Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Skil A G 3: 31,151,544 (GRCm39) E22G probably benign Het
Slc13a1 T C 6: 24,134,407 (GRCm39) I159V probably benign Het
Slc44a4 A G 17: 35,136,331 (GRCm39) I41V probably benign Het
Taar2 T C 10: 23,817,038 (GRCm39) F193L probably damaging Het
Taar8a A G 10: 23,952,995 (GRCm39) I200V probably benign Het
Trpc4 A G 3: 54,223,215 (GRCm39) Y717C probably damaging Het
Vmn2r116 A T 17: 23,620,065 (GRCm39) T600S probably damaging Het
Vwa1 G A 4: 155,857,336 (GRCm39) P154L probably damaging Het
Zfp318 A G 17: 46,722,055 (GRCm39) T1353A probably damaging Het
Zfp830 C T 11: 82,655,805 (GRCm39) T203I possibly damaging Het
Other mutations in Miip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Miip APN 4 147,950,322 (GRCm39) missense probably damaging 1.00
IGL02134:Miip APN 4 147,949,735 (GRCm39) splice site probably benign
IGL02829:Miip APN 4 147,947,518 (GRCm39) missense probably benign 0.01
IGL03350:Miip APN 4 147,946,979 (GRCm39) missense probably benign 0.01
R0200:Miip UTSW 4 147,946,720 (GRCm39) missense probably damaging 0.99
R1647:Miip UTSW 4 147,949,691 (GRCm39) missense probably benign 0.02
R1783:Miip UTSW 4 147,950,231 (GRCm39) missense probably damaging 1.00
R1848:Miip UTSW 4 147,947,549 (GRCm39) missense probably damaging 0.99
R1944:Miip UTSW 4 147,950,422 (GRCm39) missense probably benign 0.15
R3615:Miip UTSW 4 147,950,371 (GRCm39) missense probably benign 0.00
R3616:Miip UTSW 4 147,950,371 (GRCm39) missense probably benign 0.00
R3882:Miip UTSW 4 147,945,509 (GRCm39) missense possibly damaging 0.93
R4579:Miip UTSW 4 147,945,518 (GRCm39) missense probably damaging 1.00
R5183:Miip UTSW 4 147,947,526 (GRCm39) missense probably damaging 1.00
R6054:Miip UTSW 4 147,950,135 (GRCm39) missense probably benign 0.00
R6056:Miip UTSW 4 147,946,792 (GRCm39) missense probably damaging 1.00
R6304:Miip UTSW 4 147,947,540 (GRCm39) missense probably benign 0.12
R6568:Miip UTSW 4 147,950,372 (GRCm39) missense probably benign
R6603:Miip UTSW 4 147,950,380 (GRCm39) missense possibly damaging 0.92
R7639:Miip UTSW 4 147,947,021 (GRCm39) missense probably benign 0.22
R7701:Miip UTSW 4 147,947,371 (GRCm39) missense probably null 0.86
R7795:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R7796:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R7797:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R7872:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R7920:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R8468:Miip UTSW 4 147,945,928 (GRCm39) missense probably damaging 1.00
R8492:Miip UTSW 4 147,945,881 (GRCm39) missense probably damaging 1.00
R8677:Miip UTSW 4 147,947,503 (GRCm39) missense probably damaging 1.00
R8852:Miip UTSW 4 147,950,839 (GRCm39) start gained probably benign
R8860:Miip UTSW 4 147,950,839 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACCTTGGGACCTGTGTCTTG -3'
(R):5'- CAGGGTAAATTACAAGGTCCACAG -3'

Sequencing Primer
(F):5'- GTGTCTTGTCAGGTCCCAGAC -3'
(R):5'- GTCCACAGCAAGCCAGAGTG -3'
Posted On 2022-11-14