Incidental Mutation 'R9755:5830411N06Rik'
ID 732686
Institutional Source Beutler Lab
Gene Symbol 5830411N06Rik
Ensembl Gene ENSMUSG00000054672
Gene Name RIKEN cDNA 5830411N06 gene
Synonyms Scart2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9755 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 140247284-140300736 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 140261631 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093984] [ENSMUST00000164583]
AlphaFold B3F5L4
Predicted Effect probably benign
Transcript: ENSMUST00000093984
SMART Domains Protein: ENSMUSP00000091520
Gene: ENSMUSG00000054672

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
SR 238 336 1.65e-34 SMART
SR 340 440 4.53e-32 SMART
SR 446 546 8.78e-30 SMART
SR 551 651 1.26e-53 SMART
SR 656 756 2.88e-16 SMART
SR 783 883 7.62e-48 SMART
transmembrane domain 903 925 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164583
SMART Domains Protein: ENSMUSP00000131905
Gene: ENSMUSG00000054672

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
Blast:SR 291 349 5e-12 BLAST
SR 354 452 1.65e-34 SMART
SR 456 556 4.53e-32 SMART
SR 562 662 8.78e-30 SMART
SR 667 767 1.26e-53 SMART
SR 772 872 2.88e-16 SMART
SR 899 999 7.62e-48 SMART
transmembrane domain 1019 1041 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.1%
  • 20x: 97.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,651,835 M774K probably damaging Het
Adamts9 T C 6: 92,879,941 R906G probably benign Het
Adgrl4 A T 3: 151,510,781 T534S probably benign Het
Amph A T 13: 19,113,155 D357V probably damaging Het
Arhgap33 C T 7: 30,528,501 V452I possibly damaging Het
B4galnt2 G A 11: 95,883,975 Q160* probably null Het
C1galt1 T G 6: 7,867,019 N288K probably benign Het
Cacna1c T C 6: 118,674,598 D967G probably damaging Het
Cacul1 C T 19: 60,545,517 E216K probably damaging Het
Cenpq A T 17: 40,932,821 S45R probably benign Het
Cfap54 T A 10: 92,921,368 M2216L unknown Het
Cfhr1 A G 1: 139,560,151 F3S probably benign Het
Csf2rb T G 15: 78,348,624 Y710* probably null Het
Dhh A G 15: 98,895,058 V107A possibly damaging Het
Etl4 A T 2: 20,785,237 T849S probably benign Het
Gm765 A T 6: 98,248,186 N45K probably benign Het
Gnrh1 G A 14: 67,749,250 E78K possibly damaging Het
Golga3 A G 5: 110,192,981 T514A probably benign Het
Gramd1c T A 16: 43,983,516 K393N probably benign Het
Kcp T C 6: 29,492,461 Y844C probably damaging Het
Lrrc15 T A 16: 30,274,329 H64L possibly damaging Het
Mak G T 13: 41,046,147 Q339K probably benign Het
Mdfic G T 6: 15,799,759 C295F probably damaging Het
Mfsd14b C A 13: 65,073,600 V293L probably benign Het
Miip A T 4: 147,865,862 Y92* probably null Het
Mycbp2 A T 14: 103,314,370 S175T probably benign Het
Nacad A G 11: 6,599,374 probably null Het
Ndnf T G 6: 65,703,518 D260E probably benign Het
Nphp1 G A 2: 127,754,031 Q505* probably null Het
Olfr1126 C A 2: 87,457,375 A70E probably damaging Het
Olfr947-ps1 A G 9: 39,289,674 V72A possibly damaging Het
Plcg1 G A 2: 160,731,860 G15D probably benign Het
Ppm1h A G 10: 122,802,260 Y145C probably damaging Het
Prickle2 C T 6: 92,422,338 C186Y probably damaging Het
Prmt6 A C 3: 110,250,043 L310R probably damaging Het
Psg25 A T 7: 18,526,535 I146N probably benign Het
Sapcd1 A G 17: 35,026,424 S128P probably benign Het
Sema3b T C 9: 107,601,585 S331G probably damaging Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Skil A G 3: 31,097,395 E22G probably benign Het
Slc13a1 T C 6: 24,134,408 I159V probably benign Het
Slc44a4 A G 17: 34,917,355 I41V probably benign Het
Taar2 T C 10: 23,941,140 F193L probably damaging Het
Taar8a A G 10: 24,077,097 I200V probably benign Het
Trpc4 A G 3: 54,315,794 Y717C probably damaging Het
Vmn2r116 A T 17: 23,401,091 T600S probably damaging Het
Vwa1 G A 4: 155,772,879 P154L probably damaging Het
Zfp318 A G 17: 46,411,129 T1353A probably damaging Het
Zfp830 C T 11: 82,764,979 T203I possibly damaging Het
Other mutations in 5830411N06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:5830411N06Rik APN 7 140294842 missense probably damaging 0.99
IGL01101:5830411N06Rik APN 7 140296104 missense probably benign 0.35
IGL01120:5830411N06Rik APN 7 140296559 missense probably benign 0.02
IGL01958:5830411N06Rik APN 7 140274127 missense probably damaging 1.00
IGL02150:5830411N06Rik APN 7 140297859 missense possibly damaging 0.84
IGL02193:5830411N06Rik APN 7 140249000 missense probably benign 0.17
IGL02239:5830411N06Rik APN 7 140295843 missense probably damaging 1.00
IGL02335:5830411N06Rik APN 7 140296540 missense probably damaging 1.00
IGL02569:5830411N06Rik APN 7 140298362 missense probably benign 0.01
IGL02993:5830411N06Rik APN 7 140296573 missense probably benign 0.07
IGL03261:5830411N06Rik APN 7 140294833 missense probably benign 0.00
IGL03365:5830411N06Rik APN 7 140296769 missense probably damaging 1.00
IGL03399:5830411N06Rik APN 7 140247956 missense probably benign 0.00
IGL03052:5830411N06Rik UTSW 7 140248914 missense probably damaging 1.00
PIT4791001:5830411N06Rik UTSW 7 140274062 missense possibly damaging 0.53
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0347:5830411N06Rik UTSW 7 140297854 missense probably damaging 1.00
R0374:5830411N06Rik UTSW 7 140248961 missense probably damaging 1.00
R0639:5830411N06Rik UTSW 7 140247959 missense probably benign 0.01
R0667:5830411N06Rik UTSW 7 140261537 missense possibly damaging 0.73
R0789:5830411N06Rik UTSW 7 140248220 missense probably damaging 1.00
R0959:5830411N06Rik UTSW 7 140294791 missense probably damaging 1.00
R1316:5830411N06Rik UTSW 7 140299670 missense probably benign 0.09
R1764:5830411N06Rik UTSW 7 140297265 missense probably benign 0.00
R2247:5830411N06Rik UTSW 7 140249129 missense probably null 0.96
R2379:5830411N06Rik UTSW 7 140299769 missense probably benign 0.15
R4112:5830411N06Rik UTSW 7 140298368 nonsense probably null
R4114:5830411N06Rik UTSW 7 140297910 missense probably damaging 1.00
R4346:5830411N06Rik UTSW 7 140247965 missense probably damaging 0.97
R4836:5830411N06Rik UTSW 7 140299108 missense probably benign
R4956:5830411N06Rik UTSW 7 140298362 missense probably benign 0.00
R5208:5830411N06Rik UTSW 7 140298036 missense probably benign 0.00
R5571:5830411N06Rik UTSW 7 140249123 missense probably damaging 1.00
R5583:5830411N06Rik UTSW 7 140296826 missense probably damaging 1.00
R5645:5830411N06Rik UTSW 7 140248940 missense possibly damaging 0.95
R6183:5830411N06Rik UTSW 7 140296034 missense possibly damaging 0.82
R6995:5830411N06Rik UTSW 7 140261601 missense probably benign
R7436:5830411N06Rik UTSW 7 140261607 missense probably benign
R7621:5830411N06Rik UTSW 7 140296829 missense probably damaging 1.00
R7662:5830411N06Rik UTSW 7 140294812 missense possibly damaging 0.58
R7669:5830411N06Rik UTSW 7 140296321 missense possibly damaging 0.47
R7686:5830411N06Rik UTSW 7 140249052 missense probably benign 0.00
R7985:5830411N06Rik UTSW 7 140296893 missense probably damaging 1.00
R8330:5830411N06Rik UTSW 7 140296318 nonsense probably null
R8843:5830411N06Rik UTSW 7 140249000 missense possibly damaging 0.93
R8888:5830411N06Rik UTSW 7 140261619 missense possibly damaging 0.93
R8895:5830411N06Rik UTSW 7 140261619 missense possibly damaging 0.93
R9044:5830411N06Rik UTSW 7 140248097 missense probably damaging 1.00
R9142:5830411N06Rik UTSW 7 140297893 missense probably damaging 1.00
R9152:5830411N06Rik UTSW 7 140297343 missense possibly damaging 0.55
R9470:5830411N06Rik UTSW 7 140247432 missense probably benign 0.07
R9509:5830411N06Rik UTSW 7 140299731 nonsense probably null
R9522:5830411N06Rik UTSW 7 140274074 missense possibly damaging 0.73
R9794:5830411N06Rik UTSW 7 140294803 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGACAGATGACAGCTCTG -3'
(R):5'- GCATTGTGCTAGCATTAAGACAG -3'

Sequencing Primer
(F):5'- TGACAGATGACAGCTCTGATGTG -3'
(R):5'- GTGCTAGCATTAAGACAGTCACTTTG -3'
Posted On 2022-11-14