Incidental Mutation 'R9755:Nacad'
ID 732693
Institutional Source Beutler Lab
Gene Symbol Nacad
Ensembl Gene ENSMUSG00000041073
Gene Name NAC alpha domain containing
Synonyms mKIAA0363
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9755 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 6547823-6556053 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 6549374 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000049490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000388] [ENSMUST00000045713] [ENSMUST00000109721] [ENSMUST00000109722]
AlphaFold Q5SWP3
Predicted Effect probably benign
Transcript: ENSMUST00000000388
SMART Domains Protein: ENSMUSP00000000388
Gene: ENSMUSG00000000378

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Blast:PTB 60 230 2e-35 BLAST
low complexity region 242 252 N/A INTRINSIC
Pfam:CCM2_C 296 396 8.9e-50 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000045713
SMART Domains Protein: ENSMUSP00000049490
Gene: ENSMUSG00000041073

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 70 87 N/A INTRINSIC
low complexity region 228 235 N/A INTRINSIC
low complexity region 266 277 N/A INTRINSIC
low complexity region 294 306 N/A INTRINSIC
low complexity region 328 354 N/A INTRINSIC
low complexity region 391 422 N/A INTRINSIC
low complexity region 454 479 N/A INTRINSIC
internal_repeat_1 537 689 6.19e-8 PROSPERO
low complexity region 692 713 N/A INTRINSIC
internal_repeat_1 732 889 6.19e-8 PROSPERO
low complexity region 924 939 N/A INTRINSIC
low complexity region 1159 1170 N/A INTRINSIC
low complexity region 1308 1325 N/A INTRINSIC
Pfam:NAC 1357 1413 2.9e-24 PFAM
low complexity region 1449 1466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109721
SMART Domains Protein: ENSMUSP00000105343
Gene: ENSMUSG00000000378

DomainStartEndE-ValueType
Blast:PTB 2 166 2e-32 BLAST
low complexity region 178 188 N/A INTRINSIC
low complexity region 230 244 N/A INTRINSIC
PDB:4FQN|D 245 324 5e-52 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000109722
SMART Domains Protein: ENSMUSP00000105344
Gene: ENSMUSG00000000378

DomainStartEndE-ValueType
Blast:PTB 2 166 2e-32 BLAST
low complexity region 178 188 N/A INTRINSIC
low complexity region 230 244 N/A INTRINSIC
PDB:4FQN|D 245 324 5e-52 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000177050
Predicted Effect probably benign
Transcript: ENSMUST00000177391
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.1%
  • 20x: 97.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,889,292 (GRCm39) M774K probably damaging Het
Adamts9 T C 6: 92,856,922 (GRCm39) R906G probably benign Het
Adgrl4 A T 3: 151,216,418 (GRCm39) T534S probably benign Het
Amph A T 13: 19,297,325 (GRCm39) D357V probably damaging Het
Arhgap33 C T 7: 30,227,926 (GRCm39) V452I possibly damaging Het
B4galnt2 G A 11: 95,774,801 (GRCm39) Q160* probably null Het
C1galt1 T G 6: 7,867,019 (GRCm39) N288K probably benign Het
Cacna1c T C 6: 118,651,559 (GRCm39) D967G probably damaging Het
Cacul1 C T 19: 60,533,955 (GRCm39) E216K probably damaging Het
Cenpq A T 17: 41,243,712 (GRCm39) S45R probably benign Het
Cfap54 T A 10: 92,757,230 (GRCm39) M2216L unknown Het
Cfhr1 A G 1: 139,487,889 (GRCm39) F3S probably benign Het
Csf2rb T G 15: 78,232,824 (GRCm39) Y710* probably null Het
Dhh A G 15: 98,792,939 (GRCm39) V107A possibly damaging Het
Etl4 A T 2: 20,790,048 (GRCm39) T849S probably benign Het
Gnrh1 G A 14: 67,986,699 (GRCm39) E78K possibly damaging Het
Golga3 A G 5: 110,340,847 (GRCm39) T514A probably benign Het
Gramd1c T A 16: 43,803,879 (GRCm39) K393N probably benign Het
Kcp T C 6: 29,492,460 (GRCm39) Y844C probably damaging Het
Lrrc15 T A 16: 30,093,147 (GRCm39) H64L possibly damaging Het
Mak G T 13: 41,199,623 (GRCm39) Q339K probably benign Het
Mdfic G T 6: 15,799,758 (GRCm39) C295F probably damaging Het
Mdfic2 A T 6: 98,225,147 (GRCm39) N45K probably benign Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Miip A T 4: 147,950,319 (GRCm39) Y92* probably null Het
Mycbp2 A T 14: 103,551,806 (GRCm39) S175T probably benign Het
Ndnf T G 6: 65,680,502 (GRCm39) D260E probably benign Het
Nphp1 G A 2: 127,595,951 (GRCm39) Q505* probably null Het
Or12e7 C A 2: 87,287,719 (GRCm39) A70E probably damaging Het
Or8g29-ps1 A G 9: 39,200,970 (GRCm39) V72A possibly damaging Het
Plcg1 G A 2: 160,573,780 (GRCm39) G15D probably benign Het
Ppm1h A G 10: 122,638,165 (GRCm39) Y145C probably damaging Het
Prickle2 C T 6: 92,399,319 (GRCm39) C186Y probably damaging Het
Prmt6 A C 3: 110,157,359 (GRCm39) L310R probably damaging Het
Psg25 A T 7: 18,260,460 (GRCm39) I146N probably benign Het
Sapcd1 A G 17: 35,245,400 (GRCm39) S128P probably benign Het
Scart2 T A 7: 139,841,544 (GRCm39) probably null Het
Sema3b T C 9: 107,478,784 (GRCm39) S331G probably damaging Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Skil A G 3: 31,151,544 (GRCm39) E22G probably benign Het
Slc13a1 T C 6: 24,134,407 (GRCm39) I159V probably benign Het
Slc44a4 A G 17: 35,136,331 (GRCm39) I41V probably benign Het
Taar2 T C 10: 23,817,038 (GRCm39) F193L probably damaging Het
Taar8a A G 10: 23,952,995 (GRCm39) I200V probably benign Het
Trpc4 A G 3: 54,223,215 (GRCm39) Y717C probably damaging Het
Vmn2r116 A T 17: 23,620,065 (GRCm39) T600S probably damaging Het
Vwa1 G A 4: 155,857,336 (GRCm39) P154L probably damaging Het
Zfp318 A G 17: 46,722,055 (GRCm39) T1353A probably damaging Het
Zfp830 C T 11: 82,655,805 (GRCm39) T203I possibly damaging Het
Other mutations in Nacad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Nacad APN 11 6,550,921 (GRCm39) missense probably benign 0.24
IGL00903:Nacad APN 11 6,550,632 (GRCm39) missense probably damaging 0.99
IGL01303:Nacad APN 11 6,548,279 (GRCm39) missense possibly damaging 0.81
IGL01353:Nacad APN 11 6,550,530 (GRCm39) missense possibly damaging 0.70
IGL01833:Nacad APN 11 6,555,700 (GRCm39) missense unknown
IGL02267:Nacad APN 11 6,552,649 (GRCm39) missense probably benign 0.14
IGL02531:Nacad APN 11 6,548,580 (GRCm39) missense possibly damaging 0.90
IGL02994:Nacad APN 11 6,549,528 (GRCm39) missense possibly damaging 0.83
IGL03121:Nacad APN 11 6,550,933 (GRCm39) missense probably damaging 0.98
IGL03161:Nacad APN 11 6,550,378 (GRCm39) nonsense probably null
Locusta UTSW 11 6,552,387 (GRCm39) missense possibly damaging 0.88
migratoria UTSW 11 6,551,196 (GRCm39) missense probably benign 0.30
FR4340:Nacad UTSW 11 6,549,761 (GRCm39) small insertion probably benign
FR4342:Nacad UTSW 11 6,549,762 (GRCm39) small insertion probably benign
FR4548:Nacad UTSW 11 6,549,760 (GRCm39) small insertion probably benign
FR4548:Nacad UTSW 11 6,549,752 (GRCm39) small insertion probably benign
FR4589:Nacad UTSW 11 6,549,753 (GRCm39) small insertion probably benign
FR4976:Nacad UTSW 11 6,549,763 (GRCm39) small insertion probably benign
FR4976:Nacad UTSW 11 6,549,756 (GRCm39) small insertion probably benign
FR4976:Nacad UTSW 11 6,549,749 (GRCm39) small insertion probably benign
PIT4402001:Nacad UTSW 11 6,548,621 (GRCm39) missense probably benign 0.19
R0330:Nacad UTSW 11 6,550,903 (GRCm39) missense probably benign
R0331:Nacad UTSW 11 6,549,441 (GRCm39) missense possibly damaging 0.84
R0409:Nacad UTSW 11 6,549,810 (GRCm39) missense probably benign 0.00
R0612:Nacad UTSW 11 6,551,382 (GRCm39) missense possibly damaging 0.90
R0644:Nacad UTSW 11 6,549,486 (GRCm39) missense possibly damaging 0.69
R0829:Nacad UTSW 11 6,551,158 (GRCm39) missense probably benign 0.18
R1483:Nacad UTSW 11 6,552,217 (GRCm39) missense probably damaging 0.99
R1583:Nacad UTSW 11 6,551,185 (GRCm39) missense probably benign 0.08
R1905:Nacad UTSW 11 6,552,540 (GRCm39) missense probably benign 0.15
R1907:Nacad UTSW 11 6,552,540 (GRCm39) missense probably benign 0.15
R2361:Nacad UTSW 11 6,550,821 (GRCm39) missense probably benign
R2979:Nacad UTSW 11 6,551,424 (GRCm39) missense probably benign 0.06
R4192:Nacad UTSW 11 6,555,534 (GRCm39) missense probably benign 0.44
R4381:Nacad UTSW 11 6,550,204 (GRCm39) missense probably benign 0.18
R4539:Nacad UTSW 11 6,550,677 (GRCm39) missense possibly damaging 0.94
R4751:Nacad UTSW 11 6,555,726 (GRCm39) missense unknown
R4944:Nacad UTSW 11 6,548,507 (GRCm39) missense possibly damaging 0.95
R4962:Nacad UTSW 11 6,549,169 (GRCm39) missense probably damaging 1.00
R5102:Nacad UTSW 11 6,548,528 (GRCm39) missense probably damaging 1.00
R5189:Nacad UTSW 11 6,551,611 (GRCm39) missense probably damaging 0.98
R5296:Nacad UTSW 11 6,555,745 (GRCm39) missense unknown
R5566:Nacad UTSW 11 6,552,136 (GRCm39) missense probably damaging 1.00
R5634:Nacad UTSW 11 6,552,387 (GRCm39) missense possibly damaging 0.88
R5725:Nacad UTSW 11 6,551,643 (GRCm39) missense probably benign 0.15
R5748:Nacad UTSW 11 6,548,370 (GRCm39) nonsense probably null
R5864:Nacad UTSW 11 6,550,581 (GRCm39) missense probably benign
R5882:Nacad UTSW 11 6,548,568 (GRCm39) missense possibly damaging 0.95
R6089:Nacad UTSW 11 6,551,331 (GRCm39) missense probably benign 0.03
R6117:Nacad UTSW 11 6,549,810 (GRCm39) missense probably benign 0.00
R6161:Nacad UTSW 11 6,550,902 (GRCm39) missense probably benign
R6351:Nacad UTSW 11 6,550,165 (GRCm39) nonsense probably null
R6351:Nacad UTSW 11 6,549,235 (GRCm39) missense probably damaging 1.00
R6366:Nacad UTSW 11 6,551,196 (GRCm39) missense probably benign 0.30
R6525:Nacad UTSW 11 6,552,255 (GRCm39) missense probably damaging 1.00
R6811:Nacad UTSW 11 6,549,400 (GRCm39) missense possibly damaging 0.66
R6931:Nacad UTSW 11 6,551,877 (GRCm39) missense probably benign 0.14
R6966:Nacad UTSW 11 6,552,634 (GRCm39) missense possibly damaging 0.93
R7228:Nacad UTSW 11 6,548,412 (GRCm39) missense probably benign 0.19
R7248:Nacad UTSW 11 6,548,589 (GRCm39) nonsense probably null
R7556:Nacad UTSW 11 6,551,272 (GRCm39) missense possibly damaging 0.90
R7594:Nacad UTSW 11 6,552,457 (GRCm39) missense probably damaging 0.99
R7813:Nacad UTSW 11 6,549,071 (GRCm39) missense probably benign 0.38
R7841:Nacad UTSW 11 6,551,031 (GRCm39) missense probably benign 0.00
R8243:Nacad UTSW 11 6,552,643 (GRCm39) missense probably damaging 0.96
R8810:Nacad UTSW 11 6,552,853 (GRCm39) missense probably benign 0.15
R9042:Nacad UTSW 11 6,548,948 (GRCm39) missense possibly damaging 0.95
R9057:Nacad UTSW 11 6,550,876 (GRCm39) missense possibly damaging 0.53
R9114:Nacad UTSW 11 6,552,252 (GRCm39) missense probably damaging 1.00
R9328:Nacad UTSW 11 6,552,417 (GRCm39) missense possibly damaging 0.84
R9394:Nacad UTSW 11 6,549,390 (GRCm39) missense probably damaging 1.00
R9595:Nacad UTSW 11 6,551,790 (GRCm39) missense probably damaging 0.99
R9760:Nacad UTSW 11 6,551,662 (GRCm39) missense probably benign 0.02
T0975:Nacad UTSW 11 6,551,632 (GRCm39) missense probably benign 0.17
T0975:Nacad UTSW 11 6,551,622 (GRCm39) missense probably benign 0.03
T0975:Nacad UTSW 11 6,549,750 (GRCm39) small insertion probably benign
X0011:Nacad UTSW 11 6,551,074 (GRCm39) missense probably benign 0.00
Z1176:Nacad UTSW 11 6,552,297 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTACTCATCCAGCTCACTG -3'
(R):5'- TAGGTTTCTGGACCCTGACC -3'

Sequencing Primer
(F):5'- AGCTCACTGGACGACTCC -3'
(R):5'- AGCGTGTCAGCCTCTCAC -3'
Posted On 2022-11-14