Incidental Mutation 'R9755:Vmn2r116'
ID 732706
Institutional Source Beutler Lab
Gene Symbol Vmn2r116
Ensembl Gene ENSMUSG00000090966
Gene Name vomeronasal 2, receptor 116
Synonyms V2Rp5, EG619697
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R9755 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 23384803-23401864 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 23401091 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 600 (T600S)
Ref Sequence ENSEMBL: ENSMUSP00000128106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164856]
AlphaFold E9Q6I0
Predicted Effect probably damaging
Transcript: ENSMUST00000164856
AA Change: T600S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128106
Gene: ENSMUSG00000090966
AA Change: T600S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 4.4e-30 PFAM
Pfam:NCD3G 511 564 1.2e-22 PFAM
low complexity region 589 594 N/A INTRINSIC
Pfam:7tm_3 595 832 8.7e-57 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.1%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Female mice homozygous for a knock-out allele stimulated with male pheromone (Gm6084) fail to exhibit an increase in lordosis behavior and successful intromission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T A 7: 140,261,631 probably null Het
Acin1 A T 14: 54,651,835 M774K probably damaging Het
Adamts9 T C 6: 92,879,941 R906G probably benign Het
Adgrl4 A T 3: 151,510,781 T534S probably benign Het
Amph A T 13: 19,113,155 D357V probably damaging Het
Arhgap33 C T 7: 30,528,501 V452I possibly damaging Het
B4galnt2 G A 11: 95,883,975 Q160* probably null Het
C1galt1 T G 6: 7,867,019 N288K probably benign Het
Cacna1c T C 6: 118,674,598 D967G probably damaging Het
Cacul1 C T 19: 60,545,517 E216K probably damaging Het
Cenpq A T 17: 40,932,821 S45R probably benign Het
Cfap54 T A 10: 92,921,368 M2216L unknown Het
Cfhr1 A G 1: 139,560,151 F3S probably benign Het
Csf2rb T G 15: 78,348,624 Y710* probably null Het
Dhh A G 15: 98,895,058 V107A possibly damaging Het
Etl4 A T 2: 20,785,237 T849S probably benign Het
Gm765 A T 6: 98,248,186 N45K probably benign Het
Gnrh1 G A 14: 67,749,250 E78K possibly damaging Het
Golga3 A G 5: 110,192,981 T514A probably benign Het
Gramd1c T A 16: 43,983,516 K393N probably benign Het
Kcp T C 6: 29,492,461 Y844C probably damaging Het
Lrrc15 T A 16: 30,274,329 H64L possibly damaging Het
Mak G T 13: 41,046,147 Q339K probably benign Het
Mdfic G T 6: 15,799,759 C295F probably damaging Het
Mfsd14b C A 13: 65,073,600 V293L probably benign Het
Miip A T 4: 147,865,862 Y92* probably null Het
Mycbp2 A T 14: 103,314,370 S175T probably benign Het
Nacad A G 11: 6,599,374 probably null Het
Ndnf T G 6: 65,703,518 D260E probably benign Het
Nphp1 G A 2: 127,754,031 Q505* probably null Het
Olfr1126 C A 2: 87,457,375 A70E probably damaging Het
Olfr947-ps1 A G 9: 39,289,674 V72A possibly damaging Het
Plcg1 G A 2: 160,731,860 G15D probably benign Het
Ppm1h A G 10: 122,802,260 Y145C probably damaging Het
Prickle2 C T 6: 92,422,338 C186Y probably damaging Het
Prmt6 A C 3: 110,250,043 L310R probably damaging Het
Psg25 A T 7: 18,526,535 I146N probably benign Het
Sapcd1 A G 17: 35,026,424 S128P probably benign Het
Sema3b T C 9: 107,601,585 S331G probably damaging Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Skil A G 3: 31,097,395 E22G probably benign Het
Slc13a1 T C 6: 24,134,408 I159V probably benign Het
Slc44a4 A G 17: 34,917,355 I41V probably benign Het
Taar2 T C 10: 23,941,140 F193L probably damaging Het
Taar8a A G 10: 24,077,097 I200V probably benign Het
Trpc4 A G 3: 54,315,794 Y717C probably damaging Het
Vwa1 G A 4: 155,772,879 P154L probably damaging Het
Zfp318 A G 17: 46,411,129 T1353A probably damaging Het
Zfp830 C T 11: 82,764,979 T203I possibly damaging Het
Other mutations in Vmn2r116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Vmn2r116 APN 17 23385995 missense possibly damaging 0.94
IGL00985:Vmn2r116 APN 17 23401515 missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23397727 missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23387236 missense probably benign 0.12
IGL01383:Vmn2r116 APN 17 23401601 missense probably damaging 1.00
IGL01459:Vmn2r116 APN 17 23384929 missense probably damaging 1.00
IGL01725:Vmn2r116 APN 17 23386645 missense probably damaging 1.00
IGL02125:Vmn2r116 APN 17 23397627 splice site probably benign
IGL02170:Vmn2r116 APN 17 23384933 missense probably benign
IGL02209:Vmn2r116 APN 17 23388787 missense probably damaging 1.00
IGL02226:Vmn2r116 APN 17 23384834 missense probably null
IGL02272:Vmn2r116 APN 17 23385999 missense probably benign 0.06
IGL02272:Vmn2r116 APN 17 23386004 missense probably damaging 1.00
IGL02403:Vmn2r116 APN 17 23387364 missense probably damaging 1.00
IGL02686:Vmn2r116 APN 17 23388793 missense probably damaging 0.99
IGL02750:Vmn2r116 APN 17 23397634 splice site probably benign
IGL02977:Vmn2r116 APN 17 23388774 missense possibly damaging 0.90
PIT4449001:Vmn2r116 UTSW 17 23388947 missense probably benign 0.41
R0015:Vmn2r116 UTSW 17 23401849 missense probably benign 0.03
R0219:Vmn2r116 UTSW 17 23386098 nonsense probably null
R0281:Vmn2r116 UTSW 17 23401413 missense possibly damaging 0.90
R0415:Vmn2r116 UTSW 17 23387279 missense possibly damaging 0.55
R0592:Vmn2r116 UTSW 17 23386915 missense probably damaging 0.99
R0610:Vmn2r116 UTSW 17 23387312 missense probably damaging 1.00
R0635:Vmn2r116 UTSW 17 23386887 missense possibly damaging 0.95
R0843:Vmn2r116 UTSW 17 23400960 missense probably benign 0.01
R1329:Vmn2r116 UTSW 17 23387188 missense possibly damaging 0.89
R1396:Vmn2r116 UTSW 17 23386141 missense probably benign
R1401:Vmn2r116 UTSW 17 23386596 splice site probably benign
R1574:Vmn2r116 UTSW 17 23387089 missense probably damaging 0.99
R1574:Vmn2r116 UTSW 17 23387089 missense probably damaging 0.99
R1766:Vmn2r116 UTSW 17 23401766 missense probably damaging 0.98
R2157:Vmn2r116 UTSW 17 23401469 missense probably damaging 1.00
R3622:Vmn2r116 UTSW 17 23386051 missense probably benign 0.11
R3690:Vmn2r116 UTSW 17 23384824 missense unknown
R4298:Vmn2r116 UTSW 17 23401827 missense possibly damaging 0.69
R4373:Vmn2r116 UTSW 17 23401421 missense probably benign 0.01
R4860:Vmn2r116 UTSW 17 23401803 missense probably benign
R4941:Vmn2r116 UTSW 17 23401142 missense probably damaging 1.00
R5119:Vmn2r116 UTSW 17 23387164 missense probably benign 0.01
R5503:Vmn2r116 UTSW 17 23386804 missense probably benign 0.07
R5510:Vmn2r116 UTSW 17 23386121 missense probably damaging 1.00
R5538:Vmn2r116 UTSW 17 23401067 missense probably benign 0.00
R5689:Vmn2r116 UTSW 17 23397719 missense probably benign 0.30
R5765:Vmn2r116 UTSW 17 23401404 missense probably damaging 0.99
R5794:Vmn2r116 UTSW 17 23385968 missense probably damaging 0.99
R5807:Vmn2r116 UTSW 17 23387307 missense probably damaging 1.00
R5837:Vmn2r116 UTSW 17 23387080 missense probably damaging 1.00
R6262:Vmn2r116 UTSW 17 23387377 missense probably benign 0.03
R6298:Vmn2r116 UTSW 17 23386762 missense probably damaging 1.00
R6651:Vmn2r116 UTSW 17 23388831 nonsense probably null
R6667:Vmn2r116 UTSW 17 23401092 missense probably damaging 1.00
R7393:Vmn2r116 UTSW 17 23386125 missense probably benign 0.14
R7571:Vmn2r116 UTSW 17 23384856 splice site probably null
R7940:Vmn2r116 UTSW 17 23386972 missense probably damaging 0.99
R8510:Vmn2r116 UTSW 17 23385931 nonsense probably null
R8950:Vmn2r116 UTSW 17 23401493 missense probably damaging 1.00
R8956:Vmn2r116 UTSW 17 23386762 missense probably damaging 1.00
R8977:Vmn2r116 UTSW 17 23386942 missense possibly damaging 0.56
R9030:Vmn2r116 UTSW 17 23384890 missense possibly damaging 0.82
R9077:Vmn2r116 UTSW 17 23385982 missense probably benign 0.14
R9223:Vmn2r116 UTSW 17 23401167 missense probably damaging 1.00
R9401:Vmn2r116 UTSW 17 23401592 missense probably damaging 1.00
R9449:Vmn2r116 UTSW 17 23386945 missense probably benign 0.01
R9746:Vmn2r116 UTSW 17 23401823 missense probably benign 0.08
R9759:Vmn2r116 UTSW 17 23401386 missense possibly damaging 0.90
R9800:Vmn2r116 UTSW 17 23401425 missense probably damaging 0.97
S24628:Vmn2r116 UTSW 17 23387279 missense possibly damaging 0.55
Z1176:Vmn2r116 UTSW 17 23401428 missense probably damaging 1.00
Z1177:Vmn2r116 UTSW 17 23388892 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAGCACTTCTTCTATATGCTG -3'
(R):5'- CCAAATGTGAGTTGTTGTAGAATGC -3'

Sequencing Primer
(F):5'- GCTGAGGCTGCACTAACAATATCTTC -3'
(R):5'- TGTAGAATGCAGGTGGCTGAG -3'
Posted On 2022-11-14