Incidental Mutation 'R9755:Cacul1'
ID 732711
Institutional Source Beutler Lab
Gene Symbol Cacul1
Ensembl Gene ENSMUSG00000033417
Gene Name CDK2 associated, cullin domain 1
Synonyms 2700078E11Rik, 2810417M16Rik, 9830127L17Rik, D130033C15Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.157) question?
Stock # R9755 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 60513143-60569420 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 60533955 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 216 (E216K)
Ref Sequence ENSEMBL: ENSMUSP00000080480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081790] [ENSMUST00000111460] [ENSMUST00000166712]
AlphaFold Q8R0X2
Predicted Effect probably damaging
Transcript: ENSMUST00000081790
AA Change: E216K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080480
Gene: ENSMUSG00000033417
AA Change: E216K

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 35 56 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
low complexity region 104 128 N/A INTRINSIC
Pfam:Cullin 145 346 2.2e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111460
AA Change: E216K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107086
Gene: ENSMUSG00000033417
AA Change: E216K

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 35 56 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
low complexity region 104 128 N/A INTRINSIC
Pfam:Cullin 145 294 2.4e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166712
AA Change: E216K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127014
Gene: ENSMUSG00000033417
AA Change: E216K

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 35 56 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
low complexity region 104 128 N/A INTRINSIC
Pfam:Cullin 145 287 1.4e-15 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.1%
  • 20x: 97.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,889,292 (GRCm39) M774K probably damaging Het
Adamts9 T C 6: 92,856,922 (GRCm39) R906G probably benign Het
Adgrl4 A T 3: 151,216,418 (GRCm39) T534S probably benign Het
Amph A T 13: 19,297,325 (GRCm39) D357V probably damaging Het
Arhgap33 C T 7: 30,227,926 (GRCm39) V452I possibly damaging Het
B4galnt2 G A 11: 95,774,801 (GRCm39) Q160* probably null Het
C1galt1 T G 6: 7,867,019 (GRCm39) N288K probably benign Het
Cacna1c T C 6: 118,651,559 (GRCm39) D967G probably damaging Het
Cenpq A T 17: 41,243,712 (GRCm39) S45R probably benign Het
Cfap54 T A 10: 92,757,230 (GRCm39) M2216L unknown Het
Cfhr1 A G 1: 139,487,889 (GRCm39) F3S probably benign Het
Csf2rb T G 15: 78,232,824 (GRCm39) Y710* probably null Het
Dhh A G 15: 98,792,939 (GRCm39) V107A possibly damaging Het
Etl4 A T 2: 20,790,048 (GRCm39) T849S probably benign Het
Gnrh1 G A 14: 67,986,699 (GRCm39) E78K possibly damaging Het
Golga3 A G 5: 110,340,847 (GRCm39) T514A probably benign Het
Gramd1c T A 16: 43,803,879 (GRCm39) K393N probably benign Het
Kcp T C 6: 29,492,460 (GRCm39) Y844C probably damaging Het
Lrrc15 T A 16: 30,093,147 (GRCm39) H64L possibly damaging Het
Mak G T 13: 41,199,623 (GRCm39) Q339K probably benign Het
Mdfic G T 6: 15,799,758 (GRCm39) C295F probably damaging Het
Mdfic2 A T 6: 98,225,147 (GRCm39) N45K probably benign Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Miip A T 4: 147,950,319 (GRCm39) Y92* probably null Het
Mycbp2 A T 14: 103,551,806 (GRCm39) S175T probably benign Het
Nacad A G 11: 6,549,374 (GRCm39) probably null Het
Ndnf T G 6: 65,680,502 (GRCm39) D260E probably benign Het
Nphp1 G A 2: 127,595,951 (GRCm39) Q505* probably null Het
Or12e7 C A 2: 87,287,719 (GRCm39) A70E probably damaging Het
Or8g29-ps1 A G 9: 39,200,970 (GRCm39) V72A possibly damaging Het
Plcg1 G A 2: 160,573,780 (GRCm39) G15D probably benign Het
Ppm1h A G 10: 122,638,165 (GRCm39) Y145C probably damaging Het
Prickle2 C T 6: 92,399,319 (GRCm39) C186Y probably damaging Het
Prmt6 A C 3: 110,157,359 (GRCm39) L310R probably damaging Het
Psg25 A T 7: 18,260,460 (GRCm39) I146N probably benign Het
Sapcd1 A G 17: 35,245,400 (GRCm39) S128P probably benign Het
Scart2 T A 7: 139,841,544 (GRCm39) probably null Het
Sema3b T C 9: 107,478,784 (GRCm39) S331G probably damaging Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Skil A G 3: 31,151,544 (GRCm39) E22G probably benign Het
Slc13a1 T C 6: 24,134,407 (GRCm39) I159V probably benign Het
Slc44a4 A G 17: 35,136,331 (GRCm39) I41V probably benign Het
Taar2 T C 10: 23,817,038 (GRCm39) F193L probably damaging Het
Taar8a A G 10: 23,952,995 (GRCm39) I200V probably benign Het
Trpc4 A G 3: 54,223,215 (GRCm39) Y717C probably damaging Het
Vmn2r116 A T 17: 23,620,065 (GRCm39) T600S probably damaging Het
Vwa1 G A 4: 155,857,336 (GRCm39) P154L probably damaging Het
Zfp318 A G 17: 46,722,055 (GRCm39) T1353A probably damaging Het
Zfp830 C T 11: 82,655,805 (GRCm39) T203I possibly damaging Het
Other mutations in Cacul1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02051:Cacul1 APN 19 60,531,504 (GRCm39) missense probably damaging 1.00
IGL02614:Cacul1 APN 19 60,551,661 (GRCm39) missense possibly damaging 0.72
IGL03329:Cacul1 APN 19 60,531,489 (GRCm39) missense probably damaging 1.00
R0012:Cacul1 UTSW 19 60,552,691 (GRCm39) missense probably damaging 1.00
R0323:Cacul1 UTSW 19 60,531,498 (GRCm39) missense probably benign 0.38
R0400:Cacul1 UTSW 19 60,551,591 (GRCm39) splice site probably benign
R0472:Cacul1 UTSW 19 60,531,464 (GRCm39) missense probably damaging 1.00
R0853:Cacul1 UTSW 19 60,522,664 (GRCm39) missense probably damaging 1.00
R1169:Cacul1 UTSW 19 60,568,846 (GRCm39) missense probably damaging 0.99
R1490:Cacul1 UTSW 19 60,568,837 (GRCm39) missense probably damaging 0.99
R1840:Cacul1 UTSW 19 60,522,688 (GRCm39) nonsense probably null
R5140:Cacul1 UTSW 19 60,551,619 (GRCm39) missense probably benign 0.00
R5858:Cacul1 UTSW 19 60,517,482 (GRCm39) utr 3 prime probably benign
R5888:Cacul1 UTSW 19 60,525,902 (GRCm39) missense possibly damaging 0.62
R6629:Cacul1 UTSW 19 60,568,805 (GRCm39) missense probably benign 0.06
R6853:Cacul1 UTSW 19 60,517,904 (GRCm39) nonsense probably null
R6859:Cacul1 UTSW 19 60,522,683 (GRCm39) missense probably damaging 1.00
R7486:Cacul1 UTSW 19 60,568,868 (GRCm39) missense probably benign 0.08
R8262:Cacul1 UTSW 19 60,517,475 (GRCm39) makesense probably null
R8358:Cacul1 UTSW 19 60,551,673 (GRCm39) missense possibly damaging 0.75
R8889:Cacul1 UTSW 19 60,568,960 (GRCm39) missense probably damaging 0.99
R9357:Cacul1 UTSW 19 60,533,942 (GRCm39) missense probably benign 0.00
R9555:Cacul1 UTSW 19 60,533,887 (GRCm39) nonsense probably null
X0027:Cacul1 UTSW 19 60,531,490 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTAAACTGACTCAGGAATGGG -3'
(R):5'- CAGGTCCTAATATGGTTTGATTCC -3'

Sequencing Primer
(F):5'- GGTGACAGAGCTCTAACT -3'
(R):5'- AAGTGTCATAGAATAGACTTTGGAAC -3'
Posted On 2022-11-14