Mutagenetix > Incidental Mutation

Incidental Mutation 'R9757:Gli2'

732778

Institutional Source

Beutler Lab

Gene Symbol

Gli2

Ensembl Gene

ENSMUSG00000048402

Gene Name

GLI-Kruppel family member GLI2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9757 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

118834132-119053619 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 118845922 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 485 (C485R)

Ref Sequence

ENSEMBL: ENSMUSP00000054837 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062483] [ENSMUST00000159839] [ENSMUST00000160991] [ENSMUST00000161056] [ENSMUST00000161301] [ENSMUST00000161451] [ENSMUST00000162552] [ENSMUST00000162607]

AlphaFold

Q0VGT2

Predicted Effect

probably damaging
Transcript: ENSMUST00000062483
AA Change: C485R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000054837
Gene: ENSMUSG00000048402
AA Change: C485R

Domain	Start	End	E-Value	Type
low complexity region	5	16	N/A	INTRINSIC
low complexity region	36	43	N/A	INTRINSIC
low complexity region	259	278	N/A	INTRINSIC
ZnF_C2H2	417	442	4.98e-1	SMART
ZnF_C2H2	450	477	6.57e0	SMART
ZnF_C2H2	483	507	2.09e-3	SMART
ZnF_C2H2	513	538	4.17e-3	SMART
ZnF_C2H2	544	569	1.84e-4	SMART
low complexity region	637	657	N/A	INTRINSIC
low complexity region	876	890	N/A	INTRINSIC
low complexity region	930	945	N/A	INTRINSIC
low complexity region	1035	1053	N/A	INTRINSIC
low complexity region	1428	1435	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159839

SMART Domains

Protein: ENSMUSP00000125661
Gene: ENSMUSG00000048402

Domain	Start	End	E-Value	Type
low complexity region	5	16	N/A	INTRINSIC
low complexity region	36	43	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160991

Predicted Effect

probably benign
Transcript: ENSMUST00000161056

SMART Domains

Protein: ENSMUSP00000124768
Gene: ENSMUSG00000048402

Domain	Start	End	E-Value	Type
low complexity region	5	16	N/A	INTRINSIC
low complexity region	36	43	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161301

SMART Domains

Protein: ENSMUSP00000125342
Gene: ENSMUSG00000048402

Domain	Start	End	E-Value	Type
low complexity region	5	16	N/A	INTRINSIC
low complexity region	36	43	N/A	INTRINSIC
low complexity region	58	72	N/A	INTRINSIC
low complexity region	296	315	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161451

SMART Domains

Protein: ENSMUSP00000124132
Gene: ENSMUSG00000048402

Domain	Start	End	E-Value	Type
low complexity region	5	16	N/A	INTRINSIC
low complexity region	36	43	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162552

SMART Domains

Protein: ENSMUSP00000125059
Gene: ENSMUSG00000048402

Domain	Start	End	E-Value	Type
low complexity region	5	16	N/A	INTRINSIC
low complexity region	36	43	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162607

SMART Domains

Protein: ENSMUSP00000123808
Gene: ENSMUSG00000048402

Domain	Start	End	E-Value	Type
low complexity region	120	139	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.3%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger protein subclass of the Gli family. Members of this subclass are characterized as transcription factors which bind DNA through zinc finger motifs. These motifs contain conserved H-C links. Gli family zinc finger proteins are mediators of Sonic hedgehog (Shh) signaling and they are implicated as potent oncogenes in the embryonal carcinoma cell. The protein encoded by this gene localizes to the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. The encoded protein is associated with several phenotypes- Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit skeletal malformations, absence of floorplate and foregut, lung and anorectal defects, and altered commissural neuron guidance. Most mutants die before embryonic day 18.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl3	T	C	5: 81,465,239	V105A	probably benign	Het
Agrn	C	A	4: 156,176,778	V621L	probably benign	Het
Anapc1	A	G	2: 128,675,756	S323P	probably damaging	Het
Anxa6	T	A	11: 54,994,356	K456*	probably null	Het
C7	G	T	15: 5,045,652	T186K	probably damaging	Het
Cacna1b	T	C	2: 24,719,101	E396G	probably damaging	Het
Ccdc191	C	T	16: 43,941,807	T20I		Het
Ces1b	G	T	8: 93,079,873	P15Q	probably benign	Het
Dnah14	G	T	1: 181,685,784	A1901S	probably benign	Het
Dock3	T	C	9: 107,023,836	H310R	possibly damaging	Het
Eif2ak4	T	G	2: 118,438,917	S23R	probably benign	Het
Gm13078	A	G	4: 143,728,422	D430G	probably benign	Het
Gm17093	T	A	14: 44,521,533	W171R		Het
Ing2	G	A	8: 47,675,040		probably benign	Het
Itpkb	T	C	1: 180,332,807	I166T	probably benign	Het
Kcnj8	T	A	6: 142,570,079	I101F	probably benign	Het
Krtap6-2	C	T	16: 89,420,070	C3Y	unknown	Het
Lep	A	G	6: 29,069,084	I45V	probably benign	Het
Lrrk2	A	T	15: 91,811,026	I2355L	probably benign	Het
Mettl3	C	A	14: 52,299,904	A174S	probably benign	Het
Mmp23	T	C	4: 155,651,058	N317S	probably damaging	Het
Mybpc1	A	T	10: 88,536,395	V777E	probably damaging	Het
Nlrp9b	T	A	7: 20,048,692	C844S	probably damaging	Het
Obscn	T	C	11: 59,001,512	E6823G	probably benign	Het
Olfr220	A	T	1: 174,449,300	I226F	probably damaging	Het
Pcdhb1	A	T	18: 37,267,249	Q751L	probably benign	Het
Pdgfrl	T	A	8: 40,926,417	L16Q	possibly damaging	Het
Pdzph1	A	C	17: 58,974,903	L128*	probably null	Het
Prr36	A	T	8: 4,210,998	S940T	probably damaging	Het
Rad54l2	A	T	9: 106,717,921	I279N	probably damaging	Het
Rasgrp3	A	T	17: 75,500,724	T259S	probably damaging	Het
Rrn3	T	A	16: 13,810,569	I538N	probably damaging	Het
Sdf2l1	A	T	16: 17,130,534	D213E	probably benign	Het
Sorcs3	T	C	19: 48,722,924	Y643H	probably damaging	Het
Sval2	G	T	6: 41,861,840	C4F	possibly damaging	Het
Taldo1	A	G	7: 141,400,350	E131G	probably benign	Het
Tas2r130	T	C	6: 131,630,333	I166M	probably benign	Het
Tmem178	A	G	17: 81,000,860	Y228C	probably damaging	Het
Ttn	A	T	2: 76,782,079	L17188*	probably null	Het
Unc45b	A	G	11: 82,919,732	K273E	probably damaging	Het
Usp32	A	C	11: 85,077,329	Y169*	probably null	Het
Vmn2r9	A	T	5: 108,848,042	Y247N	possibly damaging	Het
Zkscan2	A	T	7: 123,480,087	C882*	probably null	Het

Other mutations in Gli2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01410:Gli2	APN	1	118836891	missense	probably benign
IGL01686:Gli2	APN	1	118848435	missense	probably damaging	1.00
IGL01925:Gli2	APN	1	118853376	missense	probably damaging	1.00
IGL02106:Gli2	APN	1	118836735	missense	probably benign
IGL02202:Gli2	APN	1	118836866	missense	probably damaging	0.96
IGL02255:Gli2	APN	1	118844349	critical splice donor site	probably null
IGL02437:Gli2	APN	1	118836003	missense	probably damaging	1.00
IGL02615:Gli2	APN	1	118844398	missense	probably damaging	1.00
IGL02817:Gli2	APN	1	118836371	missense	possibly damaging	0.55
IGL03294:Gli2	APN	1	118837436	missense	probably benign
fairyfly	UTSW	1	118840490	missense	possibly damaging	0.93
flea	UTSW	1	118835925	missense	probably damaging	0.99
patu_digua	UTSW	1	118837506	missense	probably damaging	1.00
BB006:Gli2	UTSW	1	118842042	missense	possibly damaging	0.88
BB016:Gli2	UTSW	1	118842042	missense	possibly damaging	0.88
R0055:Gli2	UTSW	1	118890408	intron	probably benign
R0055:Gli2	UTSW	1	118890408	intron	probably benign
R0164:Gli2	UTSW	1	118890283	intron	probably benign
R0233:Gli2	UTSW	1	118835925	missense	probably damaging	0.99
R0233:Gli2	UTSW	1	118835925	missense	probably damaging	0.99
R0308:Gli2	UTSW	1	118842062	missense	probably benign	0.00
R0418:Gli2	UTSW	1	118840490	missense	possibly damaging	0.93
R0558:Gli2	UTSW	1	118837649	missense	probably benign	0.01
R0600:Gli2	UTSW	1	118840389	missense	probably damaging	1.00
R0630:Gli2	UTSW	1	118841918	missense	possibly damaging	0.52
R0690:Gli2	UTSW	1	118844460	missense	probably damaging	1.00
R0942:Gli2	UTSW	1	118837506	missense	probably damaging	1.00
R1061:Gli2	UTSW	1	118854517	missense	possibly damaging	0.71
R1104:Gli2	UTSW	1	118853350	missense	probably damaging	1.00
R1141:Gli2	UTSW	1	118837937	missense	possibly damaging	0.71
R1344:Gli2	UTSW	1	118841936	missense	probably damaging	0.98
R1418:Gli2	UTSW	1	118841936	missense	probably damaging	0.98
R1565:Gli2	UTSW	1	118841930	missense	possibly damaging	0.57
R1605:Gli2	UTSW	1	118854560	missense	probably damaging	1.00
R1640:Gli2	UTSW	1	118836524	missense	possibly damaging	0.83
R1728:Gli2	UTSW	1	118868087	missense	possibly damaging	0.68
R1728:Gli2	UTSW	1	119002044	missense	probably benign	0.00
R1729:Gli2	UTSW	1	118868087	missense	possibly damaging	0.68
R1729:Gli2	UTSW	1	119002044	missense	probably benign	0.00
R1730:Gli2	UTSW	1	118868087	missense	possibly damaging	0.68
R1730:Gli2	UTSW	1	119002044	missense	probably benign	0.00
R1739:Gli2	UTSW	1	118868087	missense	possibly damaging	0.68
R1739:Gli2	UTSW	1	119002044	missense	probably benign	0.00
R1762:Gli2	UTSW	1	118868087	missense	possibly damaging	0.68
R1762:Gli2	UTSW	1	119002044	missense	probably benign	0.00
R1783:Gli2	UTSW	1	118868087	missense	possibly damaging	0.68
R1783:Gli2	UTSW	1	119002044	missense	probably benign	0.00
R1785:Gli2	UTSW	1	118868087	missense	possibly damaging	0.68
R1785:Gli2	UTSW	1	119002044	missense	probably benign	0.00
R1874:Gli2	UTSW	1	119002049	missense	possibly damaging	0.83
R1969:Gli2	UTSW	1	118837700	missense	probably benign	0.00
R2199:Gli2	UTSW	1	118837648	missense	possibly damaging	0.95
R2377:Gli2	UTSW	1	118837125	missense	possibly damaging	0.90
R2883:Gli2	UTSW	1	118868144	missense	probably damaging	0.97
R2924:Gli2	UTSW	1	118836359	missense	probably benign	0.00
R4363:Gli2	UTSW	1	118853370	missense	probably benign	0.00
R4430:Gli2	UTSW	1	118837244	missense	probably benign
R4463:Gli2	UTSW	1	118836008	missense	probably damaging	1.00
R4583:Gli2	UTSW	1	118842068	missense	probably benign
R4613:Gli2	UTSW	1	118837511	missense	probably damaging	1.00
R4674:Gli2	UTSW	1	118836029	missense	probably damaging	1.00
R4735:Gli2	UTSW	1	118840322	missense	probably damaging	1.00
R4770:Gli2	UTSW	1	118982588	intron	probably benign
R4936:Gli2	UTSW	1	118836140	missense	probably benign
R5137:Gli2	UTSW	1	118855503	missense	probably damaging	1.00
R5228:Gli2	UTSW	1	118836206	missense	probably damaging	1.00
R5318:Gli2	UTSW	1	118844470	missense	probably damaging	1.00
R5619:Gli2	UTSW	1	118836755	missense	probably benign	0.27
R5661:Gli2	UTSW	1	118853302	nonsense	probably null
R6005:Gli2	UTSW	1	118842064	missense	probably damaging	1.00
R6012:Gli2	UTSW	1	118837715	missense	probably damaging	0.99
R6341:Gli2	UTSW	1	118836224	missense	probably damaging	1.00
R6357:Gli2	UTSW	1	118841959	missense	probably damaging	1.00
R6425:Gli2	UTSW	1	118835894	nonsense	probably null
R6513:Gli2	UTSW	1	118855554	missense	probably damaging	1.00
R6802:Gli2	UTSW	1	118842065	missense	probably damaging	1.00
R6889:Gli2	UTSW	1	118844416	missense	probably damaging	1.00
R7259:Gli2	UTSW	1	118836534	missense	probably benign
R7378:Gli2	UTSW	1	118848492	missense	probably damaging	1.00
R7420:Gli2	UTSW	1	118835939	missense	probably benign	0.00
R7489:Gli2	UTSW	1	118838175	missense	probably benign	0.00
R7498:Gli2	UTSW	1	118835835	missense	possibly damaging	0.89
R7929:Gli2	UTSW	1	118842042	missense	possibly damaging	0.88
R8032:Gli2	UTSW	1	118836170	missense	probably damaging	0.98
R8150:Gli2	UTSW	1	118835828	missense	probably damaging	0.99
R8233:Gli2	UTSW	1	118844437	missense	probably damaging	1.00
R8282:Gli2	UTSW	1	118837971	missense	probably damaging	1.00
R8312:Gli2	UTSW	1	118868112	intron	probably benign
R8686:Gli2	UTSW	1	118836687	missense	probably benign
R8698:Gli2	UTSW	1	118842157	missense	probably damaging	1.00
R8935:Gli2	UTSW	1	118836392	missense	probably damaging	1.00
R8938:Gli2	UTSW	1	118836205	missense	probably damaging	1.00
R8955:Gli2	UTSW	1	118855457	missense	probably damaging	1.00
R9214:Gli2	UTSW	1	118868061	missense	probably damaging	1.00
R9232:Gli2	UTSW	1	118836291	missense	probably benign	0.00
R9295:Gli2	UTSW	1	118837266	missense	probably damaging	1.00
R9369:Gli2	UTSW	1	118838155	missense	probably benign	0.04
R9496:Gli2	UTSW	1	118836695	missense	probably benign	0.00
X0028:Gli2	UTSW	1	118837277	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCCTCCTCTGCCATATAAATAAATG -3'
(R):5'- GGCATAGGATGATGGTCCCTG -3'

Sequencing Primer
(F):5'- AAGCACTAACTGGGACCA -3'
(R):5'- ATGATGGTCCCTGAGGGCAG -3'

Posted On

2022-11-14