Incidental Mutation 'R9757:Pramel24'
ID 732786
Institutional Source Beutler Lab
Gene Symbol Pramel24
Ensembl Gene ENSMUSG00000046435
Gene Name PRAME like 24
Synonyms Gm13078
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.190) question?
Stock # R9757 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 143446025-143455728 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 143454992 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 430 (D430G)
Ref Sequence ENSEMBL: ENSMUSP00000077761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078695]
AlphaFold A2AGW8
Predicted Effect probably benign
Transcript: ENSMUST00000078695
AA Change: D430G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000077761
Gene: ENSMUSG00000046435
AA Change: D430G

DomainStartEndE-ValueType
SCOP:d1a4ya_ 204 412 4e-12 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T C 5: 81,613,086 (GRCm39) V105A probably benign Het
Agrn C A 4: 156,261,235 (GRCm39) V621L probably benign Het
Anapc1 A G 2: 128,517,676 (GRCm39) S323P probably damaging Het
Anxa6 T A 11: 54,885,182 (GRCm39) K456* probably null Het
C7 G T 15: 5,075,134 (GRCm39) T186K probably damaging Het
Cacna1b T C 2: 24,609,113 (GRCm39) E396G probably damaging Het
Ccdc191 C T 16: 43,762,170 (GRCm39) T20I Het
Ces1b G T 8: 93,806,501 (GRCm39) P15Q probably benign Het
Dnah14 G T 1: 181,513,349 (GRCm39) A1901S probably benign Het
Dock3 T C 9: 106,901,035 (GRCm39) H310R possibly damaging Het
Eif2ak4 T G 2: 118,269,398 (GRCm39) S23R probably benign Het
Gli2 A G 1: 118,773,652 (GRCm39) C485R probably damaging Het
Gm17093 T A 14: 44,758,990 (GRCm39) W171R Het
Ing2 G A 8: 48,128,075 (GRCm39) probably benign Het
Itpkb T C 1: 180,160,372 (GRCm39) I166T probably benign Het
Kcnj8 T A 6: 142,515,805 (GRCm39) I101F probably benign Het
Krtap6-2 C T 16: 89,216,958 (GRCm39) C3Y unknown Het
Lep A G 6: 29,069,083 (GRCm39) I45V probably benign Het
Lrrk2 A T 15: 91,695,229 (GRCm39) I2355L probably benign Het
Mettl3 C A 14: 52,537,361 (GRCm39) A174S probably benign Het
Mmp23 T C 4: 155,735,515 (GRCm39) N317S probably damaging Het
Mybpc1 A T 10: 88,372,257 (GRCm39) V777E probably damaging Het
Nlrp9b T A 7: 19,782,617 (GRCm39) C844S probably damaging Het
Obscn T C 11: 58,892,338 (GRCm39) E6823G probably benign Het
Or6y1 A T 1: 174,276,866 (GRCm39) I226F probably damaging Het
Pcdhb1 A T 18: 37,400,302 (GRCm39) Q751L probably benign Het
Pdgfrl T A 8: 41,379,454 (GRCm39) L16Q possibly damaging Het
Pdzph1 A C 17: 59,281,898 (GRCm39) L128* probably null Het
Prr36 A T 8: 4,260,998 (GRCm39) S940T probably damaging Het
Rad54l2 A T 9: 106,595,120 (GRCm39) I279N probably damaging Het
Rasgrp3 A T 17: 75,807,719 (GRCm39) T259S probably damaging Het
Rrn3 T A 16: 13,628,433 (GRCm39) I538N probably damaging Het
Sdf2l1 A T 16: 16,948,398 (GRCm39) D213E probably benign Het
Sorcs3 T C 19: 48,711,363 (GRCm39) Y643H probably damaging Het
Sval2 G T 6: 41,838,774 (GRCm39) C4F possibly damaging Het
Taldo1 A G 7: 140,980,263 (GRCm39) E131G probably benign Het
Tas2r130 T C 6: 131,607,296 (GRCm39) I166M probably benign Het
Tmem178 A G 17: 81,308,289 (GRCm39) Y228C probably damaging Het
Ttn A T 2: 76,612,423 (GRCm39) L17188* probably null Het
Unc45b A G 11: 82,810,558 (GRCm39) K273E probably damaging Het
Usp32 A C 11: 84,968,155 (GRCm39) Y169* probably null Het
Vmn2r9 A T 5: 108,995,908 (GRCm39) Y247N possibly damaging Het
Zkscan2 A T 7: 123,079,310 (GRCm39) C882* probably null Het
Other mutations in Pramel24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Pramel24 APN 4 143,453,585 (GRCm39) missense probably damaging 1.00
IGL01122:Pramel24 APN 4 143,454,971 (GRCm39) missense probably benign 0.13
IGL02314:Pramel24 APN 4 143,455,012 (GRCm39) missense probably benign 0.00
IGL03089:Pramel24 APN 4 143,452,703 (GRCm39) missense probably benign 0.43
IGL03338:Pramel24 APN 4 143,453,312 (GRCm39) missense probably benign 0.01
R0233:Pramel24 UTSW 4 143,452,633 (GRCm39) missense possibly damaging 0.71
R0233:Pramel24 UTSW 4 143,452,633 (GRCm39) missense possibly damaging 0.71
R0349:Pramel24 UTSW 4 143,453,629 (GRCm39) missense probably benign 0.00
R0681:Pramel24 UTSW 4 143,454,622 (GRCm39) missense probably benign
R0963:Pramel24 UTSW 4 143,453,678 (GRCm39) missense possibly damaging 0.50
R1114:Pramel24 UTSW 4 143,453,425 (GRCm39) missense probably benign 0.01
R2070:Pramel24 UTSW 4 143,453,472 (GRCm39) nonsense probably null
R2475:Pramel24 UTSW 4 143,453,395 (GRCm39) missense probably benign 0.14
R3824:Pramel24 UTSW 4 143,453,255 (GRCm39) missense probably benign 0.00
R4050:Pramel24 UTSW 4 143,453,692 (GRCm39) missense probably benign 0.01
R4125:Pramel24 UTSW 4 143,452,850 (GRCm39) nonsense probably null
R4273:Pramel24 UTSW 4 143,453,416 (GRCm39) nonsense probably null
R4280:Pramel24 UTSW 4 143,452,592 (GRCm39) missense possibly damaging 0.94
R4921:Pramel24 UTSW 4 143,454,896 (GRCm39) missense possibly damaging 0.95
R5223:Pramel24 UTSW 4 143,454,591 (GRCm39) missense probably benign 0.00
R7256:Pramel24 UTSW 4 143,452,849 (GRCm39) missense probably benign 0.23
R7640:Pramel24 UTSW 4 143,453,276 (GRCm39) missense probably benign 0.00
R7666:Pramel24 UTSW 4 143,455,085 (GRCm39) missense probably benign 0.00
R7683:Pramel24 UTSW 4 143,453,284 (GRCm39) nonsense probably null
R7981:Pramel24 UTSW 4 143,453,452 (GRCm39) missense probably benign 0.01
R8856:Pramel24 UTSW 4 143,453,303 (GRCm39) missense probably benign 0.33
R9050:Pramel24 UTSW 4 143,453,329 (GRCm39) missense probably benign 0.03
R9739:Pramel24 UTSW 4 143,454,997 (GRCm39) missense possibly damaging 0.94
Z1088:Pramel24 UTSW 4 143,453,603 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTAAGCTCATGGACTGGC -3'
(R):5'- ATGAGTCACTTGAGACCTGC -3'

Sequencing Primer
(F):5'- CTGTAAGCTCATGGACTGGCAAATC -3'
(R):5'- GAGACCTGCCTTCCATTTGTTAGAAC -3'
Posted On 2022-11-14