Incidental Mutation 'R9757:Lep'
ID 732791
Institutional Source Beutler Lab
Gene Symbol Lep
Ensembl Gene ENSMUSG00000059201
Gene Name leptin
Synonyms ob
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_008493.3; MGI:104663
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9757 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 29060220-29073877 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 29069084 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 45 (I45V)
Ref Sequence ENSEMBL: ENSMUSP00000067046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069789] [ENSMUST00000169505]
AlphaFold P41160
Predicted Effect probably benign
Transcript: ENSMUST00000069789
AA Change: I45V

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000067046
Gene: ENSMUSG00000059201
AA Change: I45V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Leptin 23 167 5.8e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169505
AA Change: I45V

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000130087
Gene: ENSMUSG00000059201
AA Change: I45V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Leptin 22 98 5.9e-50 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype Strain: 1856424
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is secreted by white adipocytes, and which plays a major role in the regulation of body weight. This protein, which acts through the leptin receptor, functions as part of a signaling pathway that can inhibit food intake and/or regulate energy expenditure to maintain constancy of the adipose mass. This protein also has several endocrine functions, and is involved in the regulation of immune and inflammatory responses, hematopoiesis, angiogenesis and wound healing. Mutations in this gene and/or its regulatory regions cause severe obesity, and morbid obesity with hypogonadism. This gene has also been linked to type 2 diabetes mellitus development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes are obese, hyperphagic, have low activity, high metabolic efficiency, impaired thermogenesis, infertility and short lifespan in addition to varying other abnormalities. Strain background affects severity and course of diabetes. Heterozygotes survive fasting longer than control mice. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(3) Spontaneous(2) Chemically induced(1)
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T C 5: 81,465,239 V105A probably benign Het
Agrn C A 4: 156,176,778 V621L probably benign Het
Anapc1 A G 2: 128,675,756 S323P probably damaging Het
Anxa6 T A 11: 54,994,356 K456* probably null Het
C7 G T 15: 5,045,652 T186K probably damaging Het
Cacna1b T C 2: 24,719,101 E396G probably damaging Het
Ccdc191 C T 16: 43,941,807 T20I Het
Ces1b G T 8: 93,079,873 P15Q probably benign Het
Dnah14 G T 1: 181,685,784 A1901S probably benign Het
Dock3 T C 9: 107,023,836 H310R possibly damaging Het
Eif2ak4 T G 2: 118,438,917 S23R probably benign Het
Gli2 A G 1: 118,845,922 C485R probably damaging Het
Gm13078 A G 4: 143,728,422 D430G probably benign Het
Gm17093 T A 14: 44,521,533 W171R Het
Ing2 G A 8: 47,675,040 probably benign Het
Itpkb T C 1: 180,332,807 I166T probably benign Het
Kcnj8 T A 6: 142,570,079 I101F probably benign Het
Krtap6-2 C T 16: 89,420,070 C3Y unknown Het
Lrrk2 A T 15: 91,811,026 I2355L probably benign Het
Mettl3 C A 14: 52,299,904 A174S probably benign Het
Mmp23 T C 4: 155,651,058 N317S probably damaging Het
Mybpc1 A T 10: 88,536,395 V777E probably damaging Het
Nlrp9b T A 7: 20,048,692 C844S probably damaging Het
Obscn T C 11: 59,001,512 E6823G probably benign Het
Olfr220 A T 1: 174,449,300 I226F probably damaging Het
Pcdhb1 A T 18: 37,267,249 Q751L probably benign Het
Pdgfrl T A 8: 40,926,417 L16Q possibly damaging Het
Pdzph1 A C 17: 58,974,903 L128* probably null Het
Prr36 A T 8: 4,210,998 S940T probably damaging Het
Rad54l2 A T 9: 106,717,921 I279N probably damaging Het
Rasgrp3 A T 17: 75,500,724 T259S probably damaging Het
Rrn3 T A 16: 13,810,569 I538N probably damaging Het
Sdf2l1 A T 16: 17,130,534 D213E probably benign Het
Sorcs3 T C 19: 48,722,924 Y643H probably damaging Het
Sval2 G T 6: 41,861,840 C4F possibly damaging Het
Taldo1 A G 7: 141,400,350 E131G probably benign Het
Tas2r130 T C 6: 131,630,333 I166M probably benign Het
Tmem178 A G 17: 81,000,860 Y228C probably damaging Het
Ttn A T 2: 76,782,079 L17188* probably null Het
Unc45b A G 11: 82,919,732 K273E probably damaging Het
Usp32 A C 11: 85,077,329 Y169* probably null Het
Vmn2r9 A T 5: 108,848,042 Y247N possibly damaging Het
Zkscan2 A T 7: 123,480,087 C882* probably null Het
Other mutations in Lep
AlleleSourceChrCoordTypePredicted EffectPPH Score
potbelly UTSW 6 29068972 nonsense probably null
potbelly2 UTSW 6 29069090 missense possibly damaging 0.95
R0009:Lep UTSW 6 29068972 nonsense probably null
R1190:Lep UTSW 6 29071174 nonsense probably null
R1545:Lep UTSW 6 29070832 missense probably damaging 1.00
R1585:Lep UTSW 6 29069090 missense possibly damaging 0.95
R5253:Lep UTSW 6 29070863 missense probably damaging 1.00
R9113:Lep UTSW 6 29071094 missense probably damaging 0.98
Z1176:Lep UTSW 6 29070970 missense possibly damaging 0.50
Z1177:Lep UTSW 6 29071096 missense probably damaging 1.00
Z1177:Lep UTSW 6 29071097 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTCTGTAGGTGCAAGAAG -3'
(R):5'- GAATCATGCGATACTGGCAGTAC -3'

Sequencing Primer
(F):5'- TCTGTAGGTGCAAGAAGAAGAAGATC -3'
(R):5'- TACAACTGAGCAGTCTAGATGCTG -3'
Posted On 2022-11-14