Incidental Mutation 'R9757:Kcnj8'
ID 732794
Institutional Source Beutler Lab
Gene Symbol Kcnj8
Ensembl Gene ENSMUSG00000030247
Gene Name potassium inwardly-rectifying channel, subfamily J, member 8
Synonyms Kir6.1, sltr, gnite, slmbr
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9757 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 142564837-142571614 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 142570079 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 101 (I101F)
Ref Sequence ENSEMBL: ENSMUSP00000145440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032374] [ENSMUST00000203945]
AlphaFold P97794
Predicted Effect probably benign
Transcript: ENSMUST00000032374
AA Change: I101F

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000032374
Gene: ENSMUSG00000030247
AA Change: I101F

DomainStartEndE-ValueType
Pfam:IRK 37 371 2.3e-141 PFAM
low complexity region 378 404 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203945
AA Change: I101F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000145440
Gene: ENSMUSG00000030247
AA Change: I101F

DomainStartEndE-ValueType
Pfam:IRK 37 371 2.3e-141 PFAM
low complexity region 378 404 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins. Defects in this gene may be a cause of J-wave syndromes and sudden infant death syndrome (SIDS). [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit sudden cardiac death due to dysregulation of the vascular tonus in the coronary arteries, and exhibit a phenotype resembling Prinzmetal (or variant) angina in humans. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T C 5: 81,465,239 V105A probably benign Het
Agrn C A 4: 156,176,778 V621L probably benign Het
Anapc1 A G 2: 128,675,756 S323P probably damaging Het
Anxa6 T A 11: 54,994,356 K456* probably null Het
C7 G T 15: 5,045,652 T186K probably damaging Het
Cacna1b T C 2: 24,719,101 E396G probably damaging Het
Ccdc191 C T 16: 43,941,807 T20I Het
Ces1b G T 8: 93,079,873 P15Q probably benign Het
Dnah14 G T 1: 181,685,784 A1901S probably benign Het
Dock3 T C 9: 107,023,836 H310R possibly damaging Het
Eif2ak4 T G 2: 118,438,917 S23R probably benign Het
Gli2 A G 1: 118,845,922 C485R probably damaging Het
Gm13078 A G 4: 143,728,422 D430G probably benign Het
Gm17093 T A 14: 44,521,533 W171R Het
Ing2 G A 8: 47,675,040 probably benign Het
Itpkb T C 1: 180,332,807 I166T probably benign Het
Krtap6-2 C T 16: 89,420,070 C3Y unknown Het
Lep A G 6: 29,069,084 I45V probably benign Het
Lrrk2 A T 15: 91,811,026 I2355L probably benign Het
Mettl3 C A 14: 52,299,904 A174S probably benign Het
Mmp23 T C 4: 155,651,058 N317S probably damaging Het
Mybpc1 A T 10: 88,536,395 V777E probably damaging Het
Nlrp9b T A 7: 20,048,692 C844S probably damaging Het
Obscn T C 11: 59,001,512 E6823G probably benign Het
Olfr220 A T 1: 174,449,300 I226F probably damaging Het
Pcdhb1 A T 18: 37,267,249 Q751L probably benign Het
Pdgfrl T A 8: 40,926,417 L16Q possibly damaging Het
Pdzph1 A C 17: 58,974,903 L128* probably null Het
Prr36 A T 8: 4,210,998 S940T probably damaging Het
Rad54l2 A T 9: 106,717,921 I279N probably damaging Het
Rasgrp3 A T 17: 75,500,724 T259S probably damaging Het
Rrn3 T A 16: 13,810,569 I538N probably damaging Het
Sdf2l1 A T 16: 17,130,534 D213E probably benign Het
Sorcs3 T C 19: 48,722,924 Y643H probably damaging Het
Sval2 G T 6: 41,861,840 C4F possibly damaging Het
Taldo1 A G 7: 141,400,350 E131G probably benign Het
Tas2r130 T C 6: 131,630,333 I166M probably benign Het
Tmem178 A G 17: 81,000,860 Y228C probably damaging Het
Ttn A T 2: 76,782,079 L17188* probably null Het
Unc45b A G 11: 82,919,732 K273E probably damaging Het
Usp32 A C 11: 85,077,329 Y169* probably null Het
Vmn2r9 A T 5: 108,848,042 Y247N possibly damaging Het
Zkscan2 A T 7: 123,480,087 C882* probably null Het
Other mutations in Kcnj8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Kcnj8 APN 6 142570235 missense probably damaging 1.00
IGL02303:Kcnj8 APN 6 142570111 missense probably benign 0.01
IGL03026:Kcnj8 APN 6 142566473 critical splice acceptor site probably null
goodnight UTSW 6 large deletion
mayday UTSW 6 large deletion
slumber UTSW 6 large deletion
solitaire UTSW 6 large deletion
sos UTSW 6 142565927 missense probably damaging 1.00
R0278:Kcnj8 UTSW 6 142570348 missense probably benign 0.12
R0927:Kcnj8 UTSW 6 142565901 missense possibly damaging 0.82
R1680:Kcnj8 UTSW 6 142570189 nonsense probably null
R1864:Kcnj8 UTSW 6 142570240 missense probably damaging 1.00
R1865:Kcnj8 UTSW 6 142570240 missense probably damaging 1.00
R2087:Kcnj8 UTSW 6 142565696 missense probably benign 0.02
R4900:Kcnj8 UTSW 6 142566495 missense probably damaging 1.00
R5863:Kcnj8 UTSW 6 142565688 missense probably benign 0.02
R6493:Kcnj8 UTSW 6 142566047 missense probably damaging 1.00
R6598:Kcnj8 UTSW 6 142570233 missense probably damaging 1.00
R7068:Kcnj8 UTSW 6 142566239 missense probably damaging 1.00
R7587:Kcnj8 UTSW 6 142566339 missense probably damaging 1.00
R7698:Kcnj8 UTSW 6 142565753 missense probably damaging 1.00
R7908:Kcnj8 UTSW 6 142566029 missense probably benign 0.44
R9199:Kcnj8 UTSW 6 142566392 missense probably damaging 1.00
X0018:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
X0020:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
X0026:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
X0027:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
X0061:Kcnj8 UTSW 6 142570120 missense probably damaging 1.00
X0065:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TTCTGAACTGCCCAATGAAGAC -3'
(R):5'- TGGCCAGGAAGAGCATCATC -3'

Sequencing Primer
(F):5'- GCCCAATGAAGACCCTTTATTTCAC -3'
(R):5'- ATCGCAGCGGAGAACCTG -3'
Posted On 2022-11-14