Mutagenetix > Incidental Mutation

Incidental Mutation 'R9757:Mybpc1'

732804

Institutional Source

Beutler Lab

Gene Symbol

Mybpc1

Ensembl Gene

ENSMUSG00000020061

Gene Name

myosin binding protein C, slow-type

Synonyms

8030451F13Rik, Slow-type C-protein

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.869) question?

Stock #

R9757 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

88518279-88605152 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 88536395 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 777 (V777E)

Ref Sequence

ENSEMBL: ENSMUSP00000112699 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119185] [ENSMUST00000121629]

AlphaFold

A0A571BEN1

Predicted Effect

probably damaging
Transcript: ENSMUST00000119185
AA Change: V777E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112699
Gene: ENSMUSG00000020061
AA Change: V777E

Domain	Start	End	E-Value	Type
IG	51	147	1.96e-6	SMART
low complexity region	221	233	N/A	INTRINSIC
IG	246	325	4.53e-2	SMART
IG	335	416	1.13e-2	SMART
IG	426	506	6.97e-3	SMART
IG	519	604	2.83e-3	SMART
FN3	607	690	4.28e-10	SMART
FN3	705	788	1.49e-9	SMART
low complexity region	800	812	N/A	INTRINSIC
IG	815	898	9.06e-2	SMART
FN3	901	983	2.06e-12	SMART
IGc2	1028	1095	1.88e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000121629
AA Change: V791E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112615
Gene: ENSMUSG00000020061
AA Change: V791E

Domain	Start	End	E-Value	Type
low complexity region	8	27	N/A	INTRINSIC
IG	65	161	1.96e-6	SMART
low complexity region	235	247	N/A	INTRINSIC
IG	260	339	4.53e-2	SMART
IG	349	430	1.13e-2	SMART
IG	440	520	6.97e-3	SMART
IG	533	618	2.83e-3	SMART
FN3	621	704	4.28e-10	SMART
FN3	719	802	1.49e-9	SMART
low complexity region	814	826	N/A	INTRINSIC
IG	829	912	9.06e-2	SMART
FN3	915	997	2.06e-12	SMART
IGc2	1042	1109	1.88e-8	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000122472
Gene: ENSMUSG00000020061
AA Change: V29E

Domain	Start	End	E-Value	Type
PDB:2YUW\|A	2	52	2e-25	PDB
low complexity region	53	65	N/A	INTRINSIC
IG	68	151	9.06e-2	SMART
FN3	154	236	2.06e-12	SMART
IGc2	281	348	1.88e-8	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000119024
Gene: ENSMUSG00000020061
AA Change: V434E

Domain	Start	End	E-Value	Type
PDB:1X44\|A	2	58	1e-26	PDB
IG	66	146	6.97e-3	SMART
IG	159	244	2.83e-3	SMART
FN3	247	330	4.28e-10	SMART
FN3	345	446	1.6e-9	SMART
low complexity region	458	470	N/A	INTRINSIC
IG	473	556	9.06e-2	SMART
FN3	559	617	8.17e0	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.3%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. Myosin-binding protein C family members are myosin-associated proteins found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The encoded protein is the slow skeletal muscle isoform of myosin-binding protein C and plays an important role in muscle contraction by recruiting muscle-type creatine kinase to myosin filaments. Mutations in this gene are associated with distal arthrogryposis type I. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl3	T	C	5: 81,465,239	V105A	probably benign	Het
Agrn	C	A	4: 156,176,778	V621L	probably benign	Het
Anapc1	A	G	2: 128,675,756	S323P	probably damaging	Het
Anxa6	T	A	11: 54,994,356	K456*	probably null	Het
C7	G	T	15: 5,045,652	T186K	probably damaging	Het
Cacna1b	T	C	2: 24,719,101	E396G	probably damaging	Het
Ccdc191	C	T	16: 43,941,807	T20I		Het
Ces1b	G	T	8: 93,079,873	P15Q	probably benign	Het
Dnah14	G	T	1: 181,685,784	A1901S	probably benign	Het
Dock3	T	C	9: 107,023,836	H310R	possibly damaging	Het
Eif2ak4	T	G	2: 118,438,917	S23R	probably benign	Het
Gli2	A	G	1: 118,845,922	C485R	probably damaging	Het
Gm13078	A	G	4: 143,728,422	D430G	probably benign	Het
Gm17093	T	A	14: 44,521,533	W171R		Het
Ing2	G	A	8: 47,675,040		probably benign	Het
Itpkb	T	C	1: 180,332,807	I166T	probably benign	Het
Kcnj8	T	A	6: 142,570,079	I101F	probably benign	Het
Krtap6-2	C	T	16: 89,420,070	C3Y	unknown	Het
Lep	A	G	6: 29,069,084	I45V	probably benign	Het
Lrrk2	A	T	15: 91,811,026	I2355L	probably benign	Het
Mettl3	C	A	14: 52,299,904	A174S	probably benign	Het
Mmp23	T	C	4: 155,651,058	N317S	probably damaging	Het
Nlrp9b	T	A	7: 20,048,692	C844S	probably damaging	Het
Obscn	T	C	11: 59,001,512	E6823G	probably benign	Het
Olfr220	A	T	1: 174,449,300	I226F	probably damaging	Het
Pcdhb1	A	T	18: 37,267,249	Q751L	probably benign	Het
Pdgfrl	T	A	8: 40,926,417	L16Q	possibly damaging	Het
Pdzph1	A	C	17: 58,974,903	L128*	probably null	Het
Prr36	A	T	8: 4,210,998	S940T	probably damaging	Het
Rad54l2	A	T	9: 106,717,921	I279N	probably damaging	Het
Rasgrp3	A	T	17: 75,500,724	T259S	probably damaging	Het
Rrn3	T	A	16: 13,810,569	I538N	probably damaging	Het
Sdf2l1	A	T	16: 17,130,534	D213E	probably benign	Het
Sorcs3	T	C	19: 48,722,924	Y643H	probably damaging	Het
Sval2	G	T	6: 41,861,840	C4F	possibly damaging	Het
Taldo1	A	G	7: 141,400,350	E131G	probably benign	Het
Tas2r130	T	C	6: 131,630,333	I166M	probably benign	Het
Tmem178	A	G	17: 81,000,860	Y228C	probably damaging	Het
Ttn	A	T	2: 76,782,079	L17188*	probably null	Het
Unc45b	A	G	11: 82,919,732	K273E	probably damaging	Het
Usp32	A	C	11: 85,077,329	Y169*	probably null	Het
Vmn2r9	A	T	5: 108,848,042	Y247N	possibly damaging	Het
Zkscan2	A	T	7: 123,480,087	C882*	probably null	Het

Other mutations in Mybpc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Mybpc1	APN	10	88549262	missense	probably damaging	0.98
IGL00577:Mybpc1	APN	10	88536384	missense	probably damaging	1.00
IGL00703:Mybpc1	APN	10	88525108	splice site	probably null
IGL00964:Mybpc1	APN	10	88555742	critical splice acceptor site	probably null
IGL01738:Mybpc1	APN	10	88570645	missense	probably damaging	1.00
IGL01978:Mybpc1	APN	10	88531770	missense	probably damaging	1.00
IGL02255:Mybpc1	APN	10	88536428	missense	probably damaging	1.00
IGL02997:Mybpc1	APN	10	88526373	missense	probably damaging	1.00
R0098:Mybpc1	UTSW	10	88529564	missense	probably benign	0.02
R0240:Mybpc1	UTSW	10	88555738	missense	possibly damaging	0.59
R0240:Mybpc1	UTSW	10	88555738	missense	possibly damaging	0.59
R0449:Mybpc1	UTSW	10	88540960	missense	probably damaging	1.00
R0879:Mybpc1	UTSW	10	88571516	splice site	probably benign
R1321:Mybpc1	UTSW	10	88529541	missense	possibly damaging	0.85
R1321:Mybpc1	UTSW	10	88570601	missense	probably damaging	1.00
R1562:Mybpc1	UTSW	10	88553331	missense	probably damaging	1.00
R1783:Mybpc1	UTSW	10	88570568	missense	probably damaging	1.00
R1803:Mybpc1	UTSW	10	88553295	missense	possibly damaging	0.65
R1962:Mybpc1	UTSW	10	88548826	missense	probably damaging	1.00
R1972:Mybpc1	UTSW	10	88551542	missense	probably benign	0.00
R2006:Mybpc1	UTSW	10	88546059	missense	probably damaging	0.99
R2125:Mybpc1	UTSW	10	88573437	nonsense	probably null
R2129:Mybpc1	UTSW	10	88551452	missense	probably damaging	1.00
R2163:Mybpc1	UTSW	10	88540942	splice site	probably benign
R2200:Mybpc1	UTSW	10	88555695	missense	probably damaging	1.00
R2219:Mybpc1	UTSW	10	88555678	missense	probably damaging	1.00
R2270:Mybpc1	UTSW	10	88551407	missense	probably benign	0.01
R2961:Mybpc1	UTSW	10	88531779	missense	probably damaging	1.00
R3767:Mybpc1	UTSW	10	88570659	splice site	probably null
R4032:Mybpc1	UTSW	10	88529564	missense	probably benign	0.02
R4226:Mybpc1	UTSW	10	88573525	nonsense	probably null
R4821:Mybpc1	UTSW	10	88548865	missense	probably damaging	0.98
R4876:Mybpc1	UTSW	10	88522991	missense	probably benign
R4876:Mybpc1	UTSW	10	88536424	missense	probably benign	0.03
R4878:Mybpc1	UTSW	10	88551430	missense	possibly damaging	0.95
R4910:Mybpc1	UTSW	10	88555724	nonsense	probably null
R4913:Mybpc1	UTSW	10	88553254	critical splice donor site	probably null
R4964:Mybpc1	UTSW	10	88555663	missense	probably benign	0.31
R5023:Mybpc1	UTSW	10	88543774	missense	probably damaging	1.00
R5098:Mybpc1	UTSW	10	88546064	missense	probably damaging	1.00
R5196:Mybpc1	UTSW	10	88536351	missense	probably damaging	0.97
R5344:Mybpc1	UTSW	10	88570568	missense	probably damaging	1.00
R5399:Mybpc1	UTSW	10	88523014	missense	probably damaging	1.00
R5538:Mybpc1	UTSW	10	88546029	missense	possibly damaging	0.89
R5808:Mybpc1	UTSW	10	88570566	missense	possibly damaging	0.83
R5970:Mybpc1	UTSW	10	88542456	missense	probably damaging	1.00
R6324:Mybpc1	UTSW	10	88568619	missense	possibly damaging	0.56
R6433:Mybpc1	UTSW	10	88560355	missense	probably damaging	1.00
R6441:Mybpc1	UTSW	10	88553277	missense	probably benign	0.09
R6648:Mybpc1	UTSW	10	88522999	missense	probably damaging	0.96
R6844:Mybpc1	UTSW	10	88536381	missense	possibly damaging	0.50
R6931:Mybpc1	UTSW	10	88542330	nonsense	probably null
R6972:Mybpc1	UTSW	10	88560361	missense	possibly damaging	0.50
R6973:Mybpc1	UTSW	10	88560361	missense	possibly damaging	0.50
R6978:Mybpc1	UTSW	10	88523024	missense	probably damaging	1.00
R7007:Mybpc1	UTSW	10	88553412	missense	probably damaging	1.00
R7019:Mybpc1	UTSW	10	88543719	missense	probably damaging	1.00
R7407:Mybpc1	UTSW	10	88549347	missense	probably damaging	0.99
R7442:Mybpc1	UTSW	10	88526293	missense	probably damaging	1.00
R7577:Mybpc1	UTSW	10	88549325	missense	probably damaging	1.00
R7660:Mybpc1	UTSW	10	88548854	missense	possibly damaging	0.51
R7768:Mybpc1	UTSW	10	88542372	missense	probably damaging	1.00
R7818:Mybpc1	UTSW	10	88558667	missense	probably damaging	1.00
R8171:Mybpc1	UTSW	10	88523003	missense	probably damaging	1.00
R8195:Mybpc1	UTSW	10	88558691	missense	possibly damaging	0.47
R8241:Mybpc1	UTSW	10	88536424	missense	probably benign	0.03
R8360:Mybpc1	UTSW	10	88573497	nonsense	probably null
R8494:Mybpc1	UTSW	10	88526429	missense	probably benign	0.01
R8849:Mybpc1	UTSW	10	88571585	missense	probably benign	0.01
R8936:Mybpc1	UTSW	10	88558575	missense	probably benign	0.44
R9031:Mybpc1	UTSW	10	88523044	missense	probably damaging	0.99
R9061:Mybpc1	UTSW	10	88555639	missense	probably damaging	1.00
R9081:Mybpc1	UTSW	10	88553306	missense	probably damaging	1.00
R9172:Mybpc1	UTSW	10	88543753	missense	possibly damaging	0.93
R9323:Mybpc1	UTSW	10	88524967	critical splice donor site	probably null
R9460:Mybpc1	UTSW	10	88536335	missense	probably damaging	0.99
R9488:Mybpc1	UTSW	10	88543762	missense	possibly damaging	0.47
R9796:Mybpc1	UTSW	10	88570635	missense	possibly damaging	0.56
Z1176:Mybpc1	UTSW	10	88560327	missense	probably benign
Z1177:Mybpc1	UTSW	10	88573437	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CATTTGGCCTTTGCTGGTAC -3'
(R):5'- AGACCCTGTTCTTTCCAAAGGATC -3'

Sequencing Primer
(F):5'- TTTGAGAGGGATCCACTAGCC -3'
(R):5'- GAAATGCTAAGTTAGAATTGGTTGTG -3'

Posted On

2022-11-14